miRTarBase - #MIRT587614


—
pre-miRNA Information
pre-miRNA mmu-mir-669m-1   
Genomic Coordinates chr2: 10512790 - 10512887
Synonyms mmu-mir-669m-1, Mir669m-1
Description Mus musculus miR-669m-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-669m-2   
Genomic Coordinates chr2: 10513434 - 10513531
Synonyms mmu-mir-669m-2, Mir669m-2
Description Mus musculus miR-669m-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-669m-5p
Sequence 25| UGUGUGCAUGUGCAUGUGUGUAU |47
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Cml2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uauguguGUACGUGUACGUGUGu 5'
                 :|||  : ||||||| 
Target 5' ----uguUAUG--UUUGCACACa 3'
 		1 - 17
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_053096 | 3UTR | UGUUAUGUUUGCACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
87 mmu-miR-669m-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577337 Zfp157 zinc finger protein 157 2 2
MIRT577486 Tns4 tensin 4 2 6
MIRT578069 Oxsm 3-oxoacyl-ACP synthase, mitochondrial 2 2
MIRT578341 Ltf lactotransferrin 2 2
MIRT578746 Gm4841 predicted gene 4841 2 4
MIRT578823 Fermt1 fermitin family member 1 2 2
MIRT579125 Chrnd cholinergic receptor, nicotinic, delta polypeptide 2 2
MIRT579138 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT579308 BC021785 major facilitator superfamily domain containing 4B5 2 4
MIRT579418 Agtrap angiotensin II, type I receptor-associated protein 2 2
MIRT579730 Zfp92 zinc finger protein 92 2 4
MIRT579980 Wrn Werner syndrome RecQ like helicase 2 4
MIRT581036 Sim1 single-minded homolog 1 (Drosophila) 2 4
MIRT581534 Pten phosphatase and tensin homolog 2 2
MIRT582315 Nab1 Ngfi-A binding protein 1 2 4
MIRT582845 Itga9 integrin alpha 9 2 4
MIRT582975 Igf2 insulin-like growth factor 2 2 4
MIRT583471 Foxk1 forkhead box K1 2 4
MIRT584664 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 2 4
MIRT585223 Zfp488 zinc finger protein 488 2 4
MIRT585300 Zfp26 zinc finger protein 26 2 2
MIRT585313 Zfp248 zinc finger protein 248 2 4
MIRT585836 Slc6a17 solute carrier family 6 (neurotransmitter transporter), member 17 2 4
MIRT586076 Rhobtb1 Rho-related BTB domain containing 1 2 2
MIRT586328 Pgm5 phosphoglucomutase 5 2 4
MIRT587380 Dzip3 DAZ interacting protein 3, zinc finger 2 2
MIRT587614 Cml2 N-acetyltransferase 8 (GCN5-related) family member 2 2 2
MIRT587630 Clec7a C-type lectin domain family 7, member a 2 8
MIRT587724 Cd28 CD28 antigen 2 2
MIRT587756 Cd200r1 CD200 receptor 1 2 2
MIRT588014 Akap7 A kinase (PRKA) anchor protein 7 2 2
MIRT588297 1700019G17Rik N-acetyltransferase 8 (GCN5-related) family member 4 2 2
MIRT588558 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 2 2
MIRT588688 Tet2 tet methylcytosine dioxygenase 2 2 2
MIRT588895 Slc1a2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 2 4
MIRT589020 Rnf11 ring finger protein 11 2 2
MIRT589098 Rasal2 RAS protein activator like 2 2 4
MIRT590108 Etv3 ets variant 3 2 2
MIRT590173 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 2 4
MIRT590925 Tacr2 tachykinin receptor 2 2 2
MIRT591064 Ptpre protein tyrosine phosphatase, receptor type, E 2 4
MIRT591145 Nsun3 NOL1/NOP2/Sun domain family member 3 2 2
MIRT591206 Mdm2 transformed mouse 3T3 cell double minute 2 2 2
MIRT591428 Car10 carbonic anhydrase 10 2 4
MIRT591504 Acot2 acyl-CoA thioesterase 2 2 4
MIRT591558 Zfp449 zinc finger protein 449 2 2
MIRT591634 Ubtf upstream binding transcription factor, RNA polymerase I 2 4
MIRT591949 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 2 2
MIRT591975 Ap1ar adaptor-related protein complex 1 associated regulatory protein 2 2
MIRT592039 Tnfrsf13c tumor necrosis factor receptor superfamily, member 13c 2 2
MIRT592090 Smo smoothened, frizzled class receptor 2 2
MIRT592111 Slc25a12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 2 2
MIRT592172 Oxtr oxytocin receptor 2 2
MIRT592215 Map3k7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT592225 Magee2 melanoma antigen, family E, 2 2 6
MIRT592248 Lcp2 lymphocyte cytosolic protein 2 2 4
MIRT592265 Kcnj16 potassium inwardly-rectifying channel, subfamily J, member 16 2 2
MIRT592389 Trp53i11 transformation related protein 53 inducible protein 11 2 6
MIRT592424 Stxbp5l syntaxin binding protein 5-like 2 2
MIRT592444 Snx12 sorting nexin 12 2 2
MIRT592518 Npr3 natriuretic peptide receptor 3 2 2
MIRT592624 Mbnl3 muscleblind like splicing factor 3 2 4
MIRT592705 Gfra2 glial cell line derived neurotrophic factor family receptor alpha 2 2 2
MIRT592745 Epas1 endothelial PAS domain protein 1 2 2
MIRT592762 Dmd dystrophin, muscular dystrophy 2 4
MIRT592846 Akap2 A kinase (PRKA) anchor protein 2 2 2
MIRT592988 Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2 2 2
MIRT593001 Bend4 BEN domain containing 4 2 2
MIRT593230 Fndc3a fibronectin type III domain containing 3A 2 2
MIRT593419 Neurod2 neurogenic differentiation 2 2 4
MIRT593451 Rab11fip1 RAB11 family interacting protein 1 (class I) 2 2
MIRT593485 Havcr2 hepatitis A virus cellular receptor 2 2 2
MIRT593515 Csf2ra colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) 2 2
MIRT594036 2810006K23Rik RIKEN cDNA 2810006K23 gene 2 2
MIRT594128 Fam104a family with sequence similarity 104, member A 1 1
MIRT595669 Rxrb retinoid X receptor beta 2 2
MIRT595702 Fndc7 fibronectin type III domain containing 7 2 2
MIRT596266 Bnc2 basonuclin 2 2 2
MIRT596280 Slc6a8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 2 2
MIRT598760 Gpr68 G protein-coupled receptor 68 2 2
MIRT601113 Btrc beta-transducin repeat containing protein 2 2
MIRT601203 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 2 2
MIRT603153 Ubxn8 UBX domain protein 8 2 2
MIRT603194 Trim65 tripartite motif-containing 65 2 2
MIRT604580 Trim71 tripartite motif-containing 71 2 2
MIRT605450 St18 suppression of tumorigenicity 18 2 2
MIRT605589 Ncam1 neural cell adhesion molecule 1 2 2

Error report submission