pre-miRNA Information
pre-miRNA mmu-mir-125a   
Genomic Coordinates chr17: 17830812 - 17830879
Description Mus musculus miR-125a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-125a-5p
Sequence 6| UCCCUGAGACCCUUUAACCUGUGA |29
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Snrnp40   
Synonyms 0610009C03Rik, Prp8bp, Wdr57
Description small nuclear ribonucleoprotein 40 (U5)
Transcript NM_025645   
Expression
Putative miRNA Targets on Snrnp40
3'UTR of Snrnp40
(miRNA target sites are highlighted)
>Snrnp40|NM_025645|3'UTR
   1 AGATGGGGAATGGAAGGCTCCCGGCTCCCAGCCCTGAGGCTCAGACTGCGGAATTGGCCAGAGTCCGATGGTGTCTGGGC
  81 TGACCTGCCTCAGATGACCATCATTAGCAAGCAGCTGGAGGTGATGGCCGTATTCCAGCAACCACTTGTACCACACTCAC
 161 CAGAACAACTGTGGCCTCTGGTACCGCCTGCCAGATTTCAGGGATTGCTTTCTTCTCTTTGAAAAATAAGATTCCTTCAG
 241 AAGGACAAACATTGGATTGATATTTCCTGTTTTTTTTTAATCTAGGCTGGAGACAGGGAATGTCAATTAAAATTTGTTAG
 321 TTGGATTTGTTTTCTGTTTTATTTTTAAATTGAATAACTGGCTTGTATGATATTTCTTTCGGTGTTTGAGTCATTTTGTA
 401 TTTGTATTAAAAATCCAAACAGATAACCTTTTTACAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUGUCCAAUUUCCCAGAGUCCCu 5'
            || |  |:   | |:|||||| 
Target 5' gtACCGCCTGCCAGATTTCAGGGa 3'
181 - 204 134.00 -14.20
2
miRNA  3' aguGUCCAAUUUCCCAGAGUCccu 5'
             ::|| |:|   | |||||   
Target 5' gtcTGGGCTGACCTGCCTCAGatg 3'
73 - 96 113.00 -8.70
3
miRNA  3' aguGUCCAAUUUCCCAGAGUCccu 5'
             |||    :|||  |||||   
Target 5' tccCAGCCCTGAGG--CTCAGact 3'
26 - 47 109.00 -10.22
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_025645 | 3UTR | GGAUUGCUUUCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
28 mmu-miR-125a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001716 Lin28a lin-28 homolog A (C. elegans) 1 1
MIRT005597 Trim71 tripartite motif-containing 71 4 3
MIRT006310 Cbx7 chromobox 7 2 1
MIRT006967 4632428N05Rik V-set immunoregulatory receptor 2 1
MIRT054177 Ptpn18 protein tyrosine phosphatase, non-receptor type 18 2 1
MIRT054178 Ptpn7 protein tyrosine phosphatase, non-receptor type 7 2 1
MIRT054179 Ppp1ca protein phosphatase 1, catalytic subunit, alpha isoform 2 1
MIRT054180 Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform 2 1
MIRT054570 Traf6 TNF receptor-associated factor 6 3 1
MIRT580227 Tspan12 tetraspanin 12 2 2
MIRT582368 Mtf1 metal response element binding transcription factor 1 2 2
MIRT582450 Mgat4a mannoside acetylglucosaminyltransferase 4, isoenzyme A 2 2
MIRT584884 Antxr2 anthrax toxin receptor 2 2 2
MIRT587193 Foxk1 forkhead box K1 2 2
MIRT588848 Snrnp40 small nuclear ribonucleoprotein 40 (U5) 2 2
MIRT591275 Lars2 leucyl-tRNA synthetase, mitochondrial 2 4
MIRT592914 Madd MAP-kinase activating death domain 2 2
MIRT594893 Il1rn interleukin 1 receptor antagonist 2 4
MIRT596427 Hif1an hypoxia-inducible factor 1, alpha subunit inhibitor 3 3
MIRT599142 Dqx1 DEAQ RNA-dependent ATPase 2 2
MIRT599717 Aph1c aph1 homolog C, gamma secretase subunit 2 2
MIRT600832 Gm14137 predicted gene 14137 2 2
MIRT604902 Jmy junction-mediating and regulatory protein 2 2
MIRT605441 Stat1 signal transducer and activator of transcription 1 2 2
MIRT606092 Wdr25 WD repeat domain 25 2 2
MIRT732537 Tnfrsf1b tumor necrosis factor receptor superfamily, member 1b 4 0
MIRT734700 VDR vitamin D receptor 2 0
MIRT734824 Sox11 SRY (sex determining region Y)-box 11 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-125a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice lung 20145010 2010 down-regulated
miR-125a Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 down-regualted
miR-125a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-125a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 up-regulated
miR-125a Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-125a 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 up-regulated
miR-125a Valproate approved 3121 Quantitative real-time PCR CD4+, CD25- T cells 20427269 2010 down-regulated
miR-125a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-125a Enoxacin approved 3229 Northern blot HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-125a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-125a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-125a-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-125a-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-125a-5p Curcumin NULL 969516 Microarray HONE1 cells 24896104 2014 down-regulated
miR-125a-5p 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-125a-5p Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-125a-5p Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-125a-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-125a-5p Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-125a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Colon Cancer tissue and cell line (HT-29)

Error report submission