miRTarBase - #MIRT589348


—
pre-miRNA Information
pre-miRNA mmu-mir-494   
Genomic Coordinates chr12: 109715318 - 109715402
Synonyms Mirn494, mmu-mir-494, Mir494
Description Mus musculus miR-494 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-494-3p
Sequence 50| UGAAACAUACACGGGAAACCUC |71
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Ostf1   
Synonyms C78236, SH3P2, Sh3d3
Description osteoclast stimulating factor 1
Transcript NM_017375   
Expression
Putative miRNA Targets on Ostf1
3'UTR of Ostf1
(miRNA target sites are highlighted)		 
>Ostf1|NM_017375|3'UTR
   1 TTCCCCCCGGGGCCGCTTTGATTGTTGCCTAAACTTCTTTTGCTTTTGCCATTCCGGAGCCTGGGTTGTTTGCCAGAAGA
  81 GTATTGATAACTGTTGCTTTTAAAGTCTGTATGAGCGCGACACTGCTGCACTGTGATCTGTGAGGAGTCGTTGTGAGGGT
 161 GGGTCATTCTCACCCACGCCTTGCCAATAAGTGAAGAGATACTTTGTTGTATAAAATACATATATGCTCACCAGGGTAAA
 241 ATAAACGAAAAAAAATTATTTCTATTTATCAAGCTAAAGGAATTGTAATAGTTTTTTTTCTTTTAAAAAAAATCATTTTT
 321 TTAAGTTCTTTACCTCAAGGAATGAGATGTTTTGAGTGGGTTTTTCAAGGGGGAAATGGTTATTATAACAATAGACCAAA
 401 ACTCTCAACAGAAAATTGTCAGCTCTTCTGACAAAAATAAACATTTAAAGAGATTTTATTATCTGTTTTTGTGCTATCAC
 481 TCATTGCTGGTAAATAAAGCTTTCTATACTCAGGTAAGAACCGATTCGATGTTACTTTTAGATCACATTTGATATTGATT
 561 AGCACAGAAGAATCACAATGCTGTGTTCCTCTCACAGCTTCCTAGTTTTGTTTTGTTTTTTTTCCGAGACAATGTTTCTC
 641 TGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCC
 721 CAAGTGCTGGGTTTAAAGGCGTGGGCCACCACCGCCTGGCTCACAGTTCAACACAGAACACAATTGCATATCTAAGAAAA
 801 GATAACACTTTAACAATTACGATATACTCAGAATTATATTCAGGGTAGTACCTAGACTGTAGAACCTCAGTGACCTCATT
 881 TCAGTTTGATTAAAGTGTGGAAGCTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuccAAAGGGCAC--AUACAAAGu 5'
              |||:||| |   ||||||| 
Target 5' ttttTTTTCCGAGACAATGTTTCt 3'
 616 - 639 160.00 -11.90
2 
miRNA  3' cuccaaagggcacaUACAAAGu 5'
                        ||||||: 
Target 5' cctcaaggaatgagATGTTTTg 3'
 333 - 354 124.00 -5.40
3 
miRNA  3' cucCAAAGGG-CACAUACAAAGu 5'
             | ||||: || | |||||: 
Target 5' acaGCTTCCTAGT-TTTGTTTTg 3'
 594 - 615 114.00 -6.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
42 mmu-miR-494-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005687 Hsf2 heat shock factor 2 1 1
MIRT006622 Pten phosphatase and tensin homolog 1 1
MIRT006623 Rock1 Rho-associated coiled-coil containing protein kinase 1 1 1
MIRT006624 Camk2b calcium/calmodulin-dependent protein kinase II beta 1 1
MIRT006625 Fgfr2 fibroblast growth factor receptor 2 1 1
MIRT006626 Lif LIF, interleukin 6 family cytokine 1 1
MIRT578347 Lsm12 LSM12 homolog 1 2
MIRT578906 Ephx3 epoxide hydrolase 3 1 3
MIRT579711 Zhx2 zinc fingers and homeoboxes 2 1 1
MIRT580333 Tnfaip1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT582377 Msrb3 methionine sulfoxide reductase B3 1 2
MIRT582618 Lrch1 leucine-rich repeats and calponin homology (CH) domain containing 1 1 1
MIRT583235 Gopc golgi associated PDZ and coiled-coil motif containing 1 1
MIRT583267 Gmeb1 glucocorticoid modulatory element binding protein 1 1 3
MIRT583415 Fyttd1 forty-two-three domain containing 1 1 1
MIRT583463 Foxk1 forkhead box K1 1 1
MIRT583788 Elovl5 ELOVL family member 5, elongation of long chain fatty acids (yeast) 1 1
MIRT583876 Dusp7 dual specificity phosphatase 7 1 1
MIRT584114 Csmd1 CUB and Sushi multiple domains 1 1 3
MIRT584936 Ado 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT585324 Zdbf2 zinc finger, DBF-type containing 2 1 1
MIRT585542 Tpte transmembrane phosphatase with tensin homology 1 1
MIRT586337 Pex13 peroxisomal biogenesis factor 13 1 2
MIRT587029 Gmip Gem-interacting protein 1 2
MIRT588763 Stxbp5 syntaxin binding protein 5 (tomosyn) 1 2
MIRT589348 Ostf1 osteoclast stimulating factor 1 1 1
MIRT589540 Mkrn3 makorin, ring finger protein, 3 1 1
MIRT590075 Faf1 Fas-associated factor 1 1 1
MIRT590633 Arl5a ADP-ribosylation factor-like 5A 1 1
MIRT592898 Otx1 orthodenticle homeobox 1 1 2
MIRT595129 Magee2 melanoma antigen, family E, 2 1 1
MIRT595134 Lrrc4c leucine rich repeat containing 4C 1 1
MIRT595443 9030617O03Rik D-glutamate cyclase 1 1
MIRT595554 Ubr3 ubiquitin protein ligase E3 component n-recognin 3 1 1
MIRT595634 Atrn attractin 1 1
MIRT595916 Syne2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT597960 Olig3 oligodendrocyte transcription factor 3 1 1
MIRT604095 Dpm1 dolichol-phosphate (beta-D) mannosyltransferase 1 1 1
MIRT605674 Itsn1 intersectin 1 (SH3 domain protein 1A) 1 1
MIRT731455 Fgfr2 fibroblast growth factor receptor 2 4 1
MIRT731456 Rock1 Rho-associated coiled-coil containing protein kinase 1 4 1
MIRT736998 Rnf41 ring finger protein 41 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-494 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 down-regualted
miR-494 Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 down-regualted
miR-494 5-aza-2'-deoxycytidine (5-Aza-CdR) + 4-phenylbutyric acid (PBA) NULL NULL Microarray T24 human bladder cancer cells 16766263 2006 up-regulated
miR-494 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-494 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-494 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-494 Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 up-regulated
miR-494 Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-494 All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 up-regulated
miR-494 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 up-regulated
miR-494 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-494 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-494 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-494 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-494 Acetaminophen approved 1983 Microarray rat liver 17965554 2007 down-regulated
miR-494 Carbon tetrachloride NULL 5943 Microarray rat liver 17965554 2007 down-regulated
miR-494 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-494-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer tissue and cell line (SW480)

Error report submission