| miRNA Infomation | |
|---|---|
| miRNA name | mmu-miR-1186b |
| Gene Information | |
|---|---|
| Gene Symbol | Stxbp2 |
| Synonyms | C79054, Munc-18-2, Munc-18b, Munc18b, Sxtbp2, Sxtp2, Unc18-2, Unc18b, muSec1 |
| Description | syntaxin binding protein 2 |
| Transcript | NM_011503 |
| Expression | |
| Putative miRNA Targets on Stxbp2 | |
| 3'UTR of Stxbp2 (miRNA target sites are highlighted) |
>Stxbp2|NM_011503|3'UTR 1 CACAGCCCCTTGCCTCTGCCCTCTCCTATTCCAGAGAAATAAACGCTTCCCTTCTGTCTTCCCACCAGGGCTCACCTCAT 81 TTTCTTCCCAGAGGGAGCTGTATTGAGCCAGACCTCCCCCTGCGTTTTCACTGTCCTGCCCGAACCTTTCCCCGGCCCCC 161 AGAAGCATCTGTAGCTTTCATTAACGCTGAGAACCTGGGCTGTAGGGTCAGTATTGGCTTGAAGTTTAGGAGGCACTGGC 241 TCTCTTGCTGGGTCCTCCATCCAAACCCAGGCCTGATTTTGGCAGAGGAGATAGAGAGGTGCAGATTAGGGGTTGCCAGG 321 GCTGCAACCCCACTGTCACTAGAGTTCTTTAGGCTGTAAGGTTAGAAATATAGGAAAAATTTTAACCTTTATCTTTATTT 401 TGTGTGTTACACTTGTATGTATGTTTATGCATCATAAGTATCAGTGCCTGTAGAGGTCAGAATAGGGTGTGGGATCCCCT 481 GGAACCAGAGTTATAAATGGTTGTGTGAAGCCATGAAGGTTCTTGAGTCTGCTGTGAGAACAGCTAGTCTCTTACCCACT 561 GATGCATCTCCAGCACCAGAAATAGAAACGGAAATAGAGTAGACCTGAATCCTGACTCTTCCCCGGAACCTCCCAGGAGC 641 TACTGCAAGTAGAACTTGAATCCCCAATTCCAGCAATCAGAGCTAGCATTTAAAATACAGCAAACTTGGGGCTGGTGAGA 721 TGGCTCAGCGGGTAAGAGCACTGACTGCTCTTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC 801 CATCCGTAATGACATCTGACGTCCTCTTCTGGTGTGTCTGAAGACAGTTACAGTGTACTTACATATGATAAATAAATAAA 881 TCTTAAAAAAATAAATAAAATACAGCAAACTCT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Liver |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
| Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
| CLIP-seq Support 1 for dataset GSM4751758 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 3 |
| Location of target site | NM_011503 | 3UTR | GGGUAAGAGCACUGACUGCUCUUCCAAAGGUCCUGAGUUCAAAUCCCAGCAACCACAUGGUGGCUCACAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4751759 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 4 |
| Location of target site | NM_011503 | 3UTR | GCUCUUCCAAAGGUCCUGAGUUCAAAUCCCAGCAACCACAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset ERR266300 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | Liver / B_Untreated |
| Location of target site | NM_011503 | 3UTR | GACUGCUCUUCCAAAGGUCCUGAGUUCAAAUCCCAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23597149 / E-MTAB-1612 |
| CLIP-seq Viewer | Link |
86 mmu-miR-1186b Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT576999 | Mark2 | MAP/microtubule affinity regulating kinase 2 |  |
|
2 | 2 | ||||||
| MIRT585120 | Zfp935 | zinc finger protein 935 | |
|
2 | 2 | ||||||
| MIRT586283 | Prc1 | protein regulator of cytokinesis 1 | |
|
2 | 4 | ||||||
| MIRT586381 | Pbld1 | phenazine biosynthesis-like protein domain containing 1 | |
|
2 | 2 | ||||||
| MIRT586708 | Loxl2 | lysyl oxidase-like 2 | |
|
2 | 4 | ||||||
| MIRT587092 | Gla | galactosidase, alpha | |
|
2 | 4 | ||||||
| MIRT587538 | Cxcr2 | chemokine (C-X-C motif) receptor 2 | |
|
2 | 2 | ||||||
| MIRT589503 | Myo1e | myosin IE | |
|
2 | 4 | ||||||
| MIRT589590 | Magt1 | magnesium transporter 1 | |
|
2 | 2 | ||||||
| MIRT590954 | Stxbp2 | syntaxin binding protein 2 | |
|
2 | 2 | ||||||
| MIRT591055 | Rab11fip1 | RAB11 family interacting protein 1 (class I) | |
|
2 | 2 | ||||||
| MIRT591076 | Polr2l | polymerase (RNA) II (DNA directed) polypeptide L | |
|
2 | 2 | ||||||
| MIRT591337 | Gm10778 | predicted gene 10778 | |
|
2 | 2 | ||||||
| MIRT592001 | Wdr34 | WD repeat domain 34 | |
|
2 | 4 | ||||||
| MIRT592296 | Foxr1 | forkhead box R1 | |
|
2 | 4 | ||||||
| MIRT593950 | Cpne1 | copine I | |
|
2 | 2 | ||||||
| MIRT593956 | Cpm | carboxypeptidase M | |
|
2 | 2 | ||||||
| MIRT595194 | Tmtc3 | transmembrane and tetratricopeptide repeat containing 3 | |
|
2 | 2 | ||||||
| MIRT595287 | Mef2c | myocyte enhancer factor 2C | |
|
2 | 2 | ||||||
| MIRT596506 | Zfp933 | zinc finger protein 933 | |
|
2 | 2 | ||||||
| MIRT596786 | Ubxn2a | UBX domain protein 2A | |
|
2 | 2 | ||||||
| MIRT597061 | Tcea1 | transcription elongation factor A (SII) 1 | |
|
2 | 2 | ||||||
| MIRT597101 | Taf1a | TATA-box binding protein associated factor, RNA polymerase I, A | |
|
2 | 2 | ||||||
| MIRT597153 | Stxbp4 | syntaxin binding protein 4 | |
|
2 | 2 | ||||||
| MIRT597459 | Rhag | Rhesus blood group-associated A glycoprotein | |
|
2 | 2 | ||||||
| MIRT597814 | Pla2g2d | phospholipase A2, group IID | |
|
2 | 2 | ||||||
| MIRT597836 | Pik3c2a | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha | |
|
2 | 2 | ||||||
| MIRT598087 | Nek7 | NIMA (never in mitosis gene a)-related expressed kinase 7 | |
|
2 | 2 | ||||||
| MIRT598275 | Med16 | mediator complex subunit 16 | |
|
2 | 2 | ||||||
| MIRT598705 | Haus2 | HAUS augmin-like complex, subunit 2 | |
|
2 | 2 | ||||||
| MIRT598887 | Glrx2 | glutaredoxin 2 (thioltransferase) | |
|
2 | 2 | ||||||
| MIRT598959 | Gemin8 | gem nuclear organelle associated protein 8 | |
|
2 | 2 | ||||||
| MIRT599390 | Clmn | calmin | |
|
2 | 2 | ||||||
| MIRT599417 | Chek2 | checkpoint kinase 2 | |
|
2 | 2 | ||||||
| MIRT599571 | Btc | betacellulin, epidermal growth factor family member | |
|
2 | 2 | ||||||
| MIRT599852 | Adarb1 | adenosine deaminase, RNA-specific, B1 | |
|
2 | 2 | ||||||
| MIRT599903 | Acat1 | acetyl-Coenzyme A acetyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT599922 | A830018L16Rik | RIKEN cDNA A830018L16 gene | |
|
2 | 2 | ||||||
| MIRT599998 | 4930579G24Rik | RIKEN cDNA 4930579G24 gene | |
|
2 | 2 | ||||||
| MIRT600123 | Zfyve27 | zinc finger, FYVE domain containing 27 | |
|
2 | 2 | ||||||
| MIRT600437 | Samd8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT600468 | Rbm4 | RNA binding motif protein 4 | |
|
2 | 2 | ||||||
| MIRT600872 | Gabpb2 | GA repeat binding protein, beta 2 | |
|
2 | 2 | ||||||
| MIRT601116 | Bri3bp | Bri3 binding protein | |
|
2 | 2 | ||||||
| MIRT601328 | Zfp689 | zinc finger protein 689 | |
|
2 | 2 | ||||||
| MIRT601448 | Tprkb | Tp53rk binding protein | |
|
2 | 2 | ||||||
| MIRT601451 | Tns4 | tensin 4 | |
|
2 | 2 | ||||||
| MIRT601483 | Tmod1 | tropomodulin 1 | |
|
2 | 2 | ||||||
| MIRT601536 | Tet1 | tet methylcytosine dioxygenase 1 | |
|
2 | 2 | ||||||
| MIRT601857 | Pkd2 | polycystic kidney disease 2 | |
|
2 | 2 | ||||||
| MIRT601946 | Nwd1 | NACHT and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT602015 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | |
|
2 | 2 | ||||||
| MIRT602020 | Moap1 | modulator of apoptosis 1 | |
|
2 | 2 | ||||||
| MIRT602190 | Hyal1 | hyaluronoglucosaminidase 1 | |
|
2 | 2 | ||||||
| MIRT602217 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT602370 | Fbxl3 | F-box and leucine-rich repeat protein 3 | |
|
2 | 2 | ||||||
| MIRT602416 | F2r | coagulation factor II (thrombin) receptor | |
|
2 | 2 | ||||||
| MIRT602429 | Ercc4 | excision repair cross-complementing rodent repair deficiency, complementation group 4 | |
|
2 | 2 | ||||||
| MIRT602495 | Dkc1 | dyskeratosis congenita 1, dyskerin | |
|
2 | 2 | ||||||
| MIRT602566 | Csf2rb | colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) | |
|
2 | 2 | ||||||
| MIRT602668 | Car5b | carbonic anhydrase 5b, mitochondrial | |
|
2 | 2 | ||||||
| MIRT602688 | Camk4 | calcium/calmodulin-dependent protein kinase IV | |
|
2 | 2 | ||||||
| MIRT602852 | Abcd2 | ATP-binding cassette, sub-family D (ALD), member 2 | |
|
2 | 2 | ||||||
| MIRT602997 | Pdzd2 | PDZ domain containing 2 | |
|
2 | 2 | ||||||
| MIRT603145 | Ubxn8 | UBX domain protein 8 | |
|
2 | 2 | ||||||
| MIRT603436 | Rpl7l1 | ribosomal protein L7-like 1 | |
|
2 | 2 | ||||||
| MIRT603456 | Rhbdl2 | rhomboid, veinlet-like 2 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT603635 | Pbxip1 | pre B cell leukemia transcription factor interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT603725 | Mrpl51 | mitochondrial ribosomal protein L51 | |
|
2 | 2 | ||||||
| MIRT603750 | Mfsd2b | major facilitator superfamily domain containing 2B | |
|
2 | 2 | ||||||
| MIRT603819 | Kif5b | kinesin family member 5B | |
|
2 | 2 | ||||||
| MIRT603907 | Hpgds | hematopoietic prostaglandin D synthase | |
|
2 | 2 | ||||||
| MIRT603918 | Hltf | helicase-like transcription factor | |
|
2 | 2 | ||||||
| MIRT603975 | Gnal | guanine nucleotide binding protein, alpha stimulating, olfactory type | |
|
2 | 2 | ||||||
| MIRT604114 | Diap2 | diaphanous related formin 2 | |
|
2 | 2 | ||||||
| MIRT604187 | Cxcl11 | chemokine (C-X-C motif) ligand 11 | |
|
2 | 2 | ||||||
| MIRT604294 | Ccdc36 | coiled-coil domain containing 36 | |
|
2 | 2 | ||||||
| MIRT604400 | Aida | axin interactor, dorsalization associated | |
|
2 | 2 | ||||||
| MIRT604629 | Syt11 | synaptotagmin XI | |
|
2 | 2 | ||||||
| MIRT604707 | Scml4 | sex comb on midleg-like 4 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT604967 | Gga2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | |
|
2 | 2 | ||||||
| MIRT605165 | C030039L03Rik | zinc finger protein 607B | |
|
2 | 2 | ||||||
| MIRT605198 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | |
|
2 | 2 | ||||||
| MIRT605619 | Mpv17 | MpV17 mitochondrial inner membrane protein | |
|
2 | 2 | ||||||
| MIRT606468 | Tcaim | T cell activation inhibitor, mitochondrial | |
1 | 1 | |||||||
| MIRT606659 | Lsm11 | U7 snRNP-specific Sm-like protein LSM11 | |
|
2 | 2 | ||||||