miRTarBase - #MIRT591164


—
pre-miRNA Information
pre-miRNA mmu-mir-677   
Genomic Coordinates chr10: 128085286 - 128085363
Synonyms Mirn677, mmu-mir-677, Mir677
Description Mus musculus miR-677 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-677-5p
Sequence 6| UUCAGUGAUGAUUAGCUUCUGA |27
Evidence Experimental
Experiments MPSS
Putative Targets

Gene Information
Gene Symbol Mup19   
Synonyms 100039247, Gm12552, Mup11, Mup14, Mup17, Mup6, Mup8
Description major urinary protein 19
Transcript NM_001135127   
Expression
Putative miRNA Targets on Mup19
3'UTR of Mup19
(miRNA target sites are highlighted)		 
>Mup19|NM_001135127|3'UTR
   1 AGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATC
  81 CCCAGTATAAATTCTGTGATCTGCATTCCATCCTGTCTCACTGAGAAGTCCAATTCCAGTCTATCCACATGTTACCTAGG
 161 ATACCTCATCAAGAATCAAAGACTTCTTTAAATTTTTCTTTGATATACCCATGACAATTTTTCATGAATTTCTTCCTCTT
 241 CCTGTTCAATAAATGATTACCCTTGCACT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucuucGAUUAGUAGUGACUu 5'
                 || :|| ||||||| 
Target 5' ttccatcCT-GTC-TCACTGAg 3'
 106 - 125 145.00 -11.60
2 
miRNA  3' agUCUUCGAUUAGUAGUGacuu 5'
            || :|  | |: ||||    
Target 5' tgAGTGGAGACTTCTCACcagg 3'
 24 - 45 92.00 -6.20
3 
miRNA  3' agucUUCGAU-UAGUAGUgacuu 5'
              |:| ||  ||||||     
Target 5' acctAGGATACCTCATCAagaat 3'
 154 - 176 82.00 -7.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in ERR266286. RNA binding protein: AGO2. Condition:A_Liver partial hapatectomy 1h HITS-CLIP data was present in ERR266293. RNA binding protein: AGO2. Condition:A_Liver partial hapatectomy 36h HITS-CLIP data was present in ERR266295. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 1h HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated ...

- Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics.

Article - Schug J; McKenna LB; Walton G; Hand N; et al.
- BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
44 mmu-miR-677-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT580133 Ubap2l ubiquitin-associated protein 2-like 1 1
MIRT582833 Itgb3 integrin beta 3 1 4
MIRT583171 Grik3 glutamate receptor, ionotropic, kainate 3 1 3
MIRT583782 Elovl7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 1 2
MIRT585951 Sin3a transcriptional regulator, SIN3A (yeast) 1 1
MIRT589768 Iws1 IWS1, SUPT6 interacting protein 1 1
MIRT591164 Mup19 major urinary protein 19 1 1
MIRT591170 Mup12 major urinary protein 12 1 1
MIRT591176 Mup10 major urinary protein 10 1 1
MIRT591807 Mup14 major urinary protein 14 1 1
MIRT592567 Mup17 major urinary protein 17 1 1
MIRT592608 Mup11 major urinary protein 11 1 1
MIRT593180 Clasp1 CLIP associating protein 1 1 1
MIRT594028 5430427O19Rik RIKEN cDNA 5430427O19 gene 1 1
MIRT595083 Zfp516 zinc finger protein 516 1 1
MIRT595535 Fign fidgetin 1 1
MIRT595555 Ubr3 ubiquitin protein ligase E3 component n-recognin 3 1 1
MIRT595557 Tcte1 t-complex-associated testis expressed 1 1 1
MIRT595562 Sptbn1 spectrin beta, non-erythrocytic 1 1 1
MIRT595569 Nrsn1 neurensin 1 1 1
MIRT595571 Mtf1 metal response element binding transcription factor 1 1 1
MIRT595579 Josd1 Josephin domain containing 1 1 1
MIRT595580 Fam101b refilin B 1 1
MIRT595587 4930444A02Rik protein-O-mannose kinase 1 1
MIRT595593 Ago1 argonaute RISC catalytic subunit 1 1 1
MIRT595602 Nbl1 neuroblastoma, suppression of tumorigenicity 1 1 1
MIRT595604 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT595625 Nol7 nucleolar protein 7 1 1
MIRT595629 Gnptg N-acetylglucosamine-1-phosphotransferase, gamma subunit 1 1
MIRT595633 Ednra endothelin receptor type A 1 1
MIRT595649 B3galt5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 1
MIRT595667 Rxrb retinoid X receptor beta 1 1
MIRT595743 Ctdspl2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT595789 Fignl2 fidgetin-like 2 1 1
MIRT595880 Gid4 GID complex subunit 4, VID24 homolog 1 1
MIRT595909 Tapt1 transmembrane anterior posterior transformation 1 1 1
MIRT595919 Trim9 tripartite motif-containing 9 1 1
MIRT595925 Efr3a EFR3 homolog A 1 1
MIRT595937 Acmsd amino carboxymuconate semialdehyde decarboxylase 1 1
MIRT595943 B3gnt5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT596004 Disp2 dispatched RND tramsporter family member 2 1 1
MIRT596008 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596167 Ms4a15 membrane-spanning 4-domains, subfamily A, member 15 1 1
MIRT597273 Slc25a33 solute carrier family 25, member 33 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-677 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated

Error report submission