pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-1907 |
Genomic Coordinates | chr15: 50889025 - 50889114 |
Synonyms | mmu-mir-1907, Mir1907 |
Description | Mus musculus miR-1907 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-1907 |
Sequence | 59| GAGCAGCAGAGGAUCUGGAGGU |80 |
Evidence | Experimental |
Experiments | Microarray |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Klc1 | ||||||||||||||||||||
Synonyms | AI874768, Kns2 | ||||||||||||||||||||
Description | kinesin light chain 1 | ||||||||||||||||||||
Transcript | NM_008450 | ||||||||||||||||||||
Other Transcripts | NM_001081959 , NM_001025360 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Klc1 | |||||||||||||||||||||
3'UTR of Klc1 (miRNA target sites are highlighted) |
>Klc1|NM_008450|3'UTR 1 CCGCCCGCCCGGTGCCTCCCCCTGCTCCTGCATGGCGGGACGGGCAGCGCCTCCTGCGGCCCCTCCAGTGCTGTCCCTCC 81 GCTGTCTAGCAGCCCTAGGGGCGTGTCAGCCGCACCTCTGGGACGGGCCCTTCCTTGCGGTGCTGCCGTCCTTTTGGGTT 161 CTTGATTTCTGGATACATGTAGCTTTGCCAGATATGTACTTAGAGATATCAACCGTGTTAATAAGCCCATTAATGTGTAA 241 CAACAAGTTTAACAGTTAAGAGAGAGTAGCTGTTCACCTTGAAGACAGGCCTTAGTGTCACGCAGGTTTATTACAGTGGC 321 ATGATGGTGACCTGTGCAGTCACTGAGCTGTAGGAGTGAGGCATGTGCTGCACGTCCCTGTCGTACTTAGAGACCTGGCC 401 GGTGCCCTGCGCGGGGCCTCCCCAGGACACACTGACGTAGATTTGCTGTGTAGTCTTGGTGTGGAAATTTGAATTCTGCT 481 TTTCTCTACTAATCTGAAGTGCTCCGTGATGTGTGTATGTGTCTTTCTAACTTCTAATAAACTCACTCCAACTGACCAAA 561 AAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | mESCs | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Liver |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated
HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
CLIP-seq Support 1 for dataset GSM4751756 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of iBAT 1 |
Location of target site | NM_001081959 | 3UTR | UGCUGCUGCUGCUGCUGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4751757 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of iBAT 2 |
Location of target site | NM_001081959 | 3UTR | UGCUGCUGCUGCUGCUGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4751758 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of iBAT 3 |
Location of target site | NM_001025360 | 3UTR | GCUGCUGCUGCUGCUGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4751760 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of eWAT 1 |
Location of target site | NM_001025360 | 3UTR | GCUGCUGCUGCUGCUGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4751761 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of eWAT 2 |
Location of target site | NM_001025360 | 3UTR | CUGCUGCUGCUGCUGCUGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM622572 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | mESCs / WT2 |
Location of target site | NM_001025360 | 3UTR | AUGCUGCUGCUGCUGCUGCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21258322 / GSE25310 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset ERR266298 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Liver / A_Untreated |
Location of target site | NM_001025360 | 3UTR | AUGCUGCUGCUGCUGCUGCUGCUGCUGAGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23597149 / E-MTAB-1612 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset ERR266300 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Liver / B_Untreated |
Location of target site | NM_001025360 | 3UTR | GACACCAUGCUGCUGCUGCUGCUGCUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23597149 / E-MTAB-1612 |
CLIP-seq Viewer | Link |
26 mmu-miR-1907 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT577814 | Rnf168 | ring finger protein 168 | 2 | 2 | ||||||||
MIRT578446 | Irgq | immunity-related GTPase family, Q | 2 | 10 | ||||||||
MIRT578975 | Dhdh | dihydrodiol dehydrogenase (dimeric) | 2 | 4 | ||||||||
MIRT583725 | Erlin2 | ER lipid raft associated 2 | 2 | 2 | ||||||||
MIRT584145 | Creb5 | cAMP responsive element binding protein 5 | 2 | 2 | ||||||||
MIRT591282 | Klc1 | kinesin light chain 1 | 2 | 4 | ||||||||
MIRT591941 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b | 2 | 2 | ||||||||
MIRT592082 | Sorcs2 | sortilin-related VPS10 domain containing receptor 2 | 2 | 2 | ||||||||
MIRT592203 | Mapkap1 | mitogen-activated protein kinase associated protein 1 | 2 | 4 | ||||||||
MIRT592344 | Armcx6 | armadillo repeat containing, X-linked 6 | 2 | 4 | ||||||||
MIRT592358 | Angel1 | angel homolog 1 | 2 | 2 | ||||||||
MIRT592371 | 4930444A02Rik | protein-O-mannose kinase | 2 | 2 | ||||||||
MIRT592405 | Tacc1 | transforming, acidic coiled-coil containing protein 1 | 2 | 4 | ||||||||
MIRT592434 | Spsb4 | splA/ryanodine receptor domain and SOCS box containing 4 | 2 | 2 | ||||||||
MIRT592663 | Itgav | integrin alpha V | 2 | 2 | ||||||||
MIRT592714 | Fbxo21 | F-box protein 21 | 2 | 4 | ||||||||
MIRT592809 | Bicd1 | bicaudal D homolog 1 (Drosophila) | 2 | 6 | ||||||||
MIRT597927 | Pacsin2 | protein kinase C and casein kinase substrate in neurons 2 | 2 | 2 | ||||||||
MIRT598101 | Ncl | nucleolin | 2 | 2 | ||||||||
MIRT598641 | Idua | iduronidase, alpha-L- | 2 | 2 | ||||||||
MIRT599013 | Fgd4 | FYVE, RhoGEF and PH domain containing 4 | 2 | 2 | ||||||||
MIRT600260 | Trim2 | tripartite motif-containing 2 | 2 | 2 | ||||||||
MIRT600290 | Tifab | TRAF-interacting protein with forkhead-associated domain, family member B | 2 | 2 | ||||||||
MIRT601128 | Bri3bp | Bri3 binding protein | 2 | 2 | ||||||||
MIRT601134 | Bcl11b | B cell leukemia/lymphoma 11B | 2 | 2 | ||||||||
MIRT603790 | Lpcat2b | lysophosphatidylcholine acyltransferase 2B | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|