pre-miRNA Information
pre-miRNA mmu-mir-1907   
Genomic Coordinates chr15: 50889025 - 50889114
Synonyms mmu-mir-1907, Mir1907
Description Mus musculus miR-1907 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-1907
Sequence 59| GAGCAGCAGAGGAUCUGGAGGU |80
Evidence Experimental
Experiments Microarray
Putative Targets

Gene Information
Gene Symbol Klc1   
Synonyms AI874768, Kns2
Description kinesin light chain 1
Transcript NM_008450   
Other Transcripts NM_001081959 , NM_001025360   
Expression
Putative miRNA Targets on Klc1
3'UTR of Klc1
(miRNA target sites are highlighted)
>Klc1|NM_008450|3'UTR
   1 CCGCCCGCCCGGTGCCTCCCCCTGCTCCTGCATGGCGGGACGGGCAGCGCCTCCTGCGGCCCCTCCAGTGCTGTCCCTCC
  81 GCTGTCTAGCAGCCCTAGGGGCGTGTCAGCCGCACCTCTGGGACGGGCCCTTCCTTGCGGTGCTGCCGTCCTTTTGGGTT
 161 CTTGATTTCTGGATACATGTAGCTTTGCCAGATATGTACTTAGAGATATCAACCGTGTTAATAAGCCCATTAATGTGTAA
 241 CAACAAGTTTAACAGTTAAGAGAGAGTAGCTGTTCACCTTGAAGACAGGCCTTAGTGTCACGCAGGTTTATTACAGTGGC
 321 ATGATGGTGACCTGTGCAGTCACTGAGCTGTAGGAGTGAGGCATGTGCTGCACGTCCCTGTCGTACTTAGAGACCTGGCC
 401 GGTGCCCTGCGCGGGGCCTCCCCAGGACACACTGACGTAGATTTGCTGTGTAGTCTTGGTGTGGAAATTTGAATTCTGCT
 481 TTTCTCTACTAATCTGAAGTGCTCCGTGATGTGTGTATGTGTCTTTCTAACTTCTAATAAACTCACTCCAACTGACCAAA
 561 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uggaggucuAGGAG----ACGACGag 5'
                   ||||:    ||||||  
Target 5' acgggccctTCCTTGCGGTGCTGCcg 3'
123 - 148 127.00 -14.80
2
miRNA  3' uggaggUCUAGGAGACGACGag 5'
                ||: | | ||||||  
Target 5' ggagtgAGG-CATGTGCTGCac 3'
353 - 373 127.00 -9.90
3
miRNA  3' ugGAGGUCUA-GGA----GACGACGAg 5'
            | || |:| |||    ||||| || 
Target 5' ccCGCCCGGTGCCTCCCCCTGCTCCTg 3'
4 - 30 126.00 -21.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uggAGGUCUAGGA-GACGACGAg 5'
             | | | | || |||||||| 
Target 5' --aUGCUGCUGCUGCUGCUGCU- 3'
1 - 20
Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated ...

- Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics.

Article - Schug J; McKenna LB; Walton G; Hand N; et al.
- BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
CLIP-seq Support 1 for dataset GSM4751756
Method / RBP HITS-CLIP / AGO
Cell line / Condition adipose tissue / RNA sequencing of iBAT 1
Location of target site NM_001081959 | 3UTR | UGCUGCUGCUGCUGCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE142677
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4751757
Method / RBP HITS-CLIP / AGO
Cell line / Condition adipose tissue / RNA sequencing of iBAT 2
Location of target site NM_001081959 | 3UTR | UGCUGCUGCUGCUGCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE142677
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4751758
Method / RBP HITS-CLIP / AGO
Cell line / Condition adipose tissue / RNA sequencing of iBAT 3
Location of target site NM_001025360 | 3UTR | GCUGCUGCUGCUGCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE142677
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4751760
Method / RBP HITS-CLIP / AGO
Cell line / Condition adipose tissue / RNA sequencing of eWAT 1
Location of target site NM_001025360 | 3UTR | GCUGCUGCUGCUGCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE142677
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4751761
Method / RBP HITS-CLIP / AGO
Cell line / Condition adipose tissue / RNA sequencing of eWAT 2
Location of target site NM_001025360 | 3UTR | CUGCUGCUGCUGCUGCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE142677
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM622572
Method / RBP HITS-CLIP / AGO2
Cell line / Condition mESCs / WT2
Location of target site NM_001025360 | 3UTR | AUGCUGCUGCUGCUGCUGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21258322 / GSE25310
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset ERR266298
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Liver / A_Untreated
Location of target site NM_001025360 | 3UTR | AUGCUGCUGCUGCUGCUGCUGCUGCUGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23597149 / E-MTAB-1612
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset ERR266300
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Liver / B_Untreated
Location of target site NM_001025360 | 3UTR | GACACCAUGCUGCUGCUGCUGCUGCUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23597149 / E-MTAB-1612
CLIP-seq Viewer Link
26 mmu-miR-1907 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577814 Rnf168 ring finger protein 168 2 2
MIRT578446 Irgq immunity-related GTPase family, Q 2 10
MIRT578975 Dhdh dihydrodiol dehydrogenase (dimeric) 2 4
MIRT583725 Erlin2 ER lipid raft associated 2 2 2
MIRT584145 Creb5 cAMP responsive element binding protein 5 2 2
MIRT591282 Klc1 kinesin light chain 1 2 4
MIRT591941 Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b 2 2
MIRT592082 Sorcs2 sortilin-related VPS10 domain containing receptor 2 2 2
MIRT592203 Mapkap1 mitogen-activated protein kinase associated protein 1 2 4
MIRT592344 Armcx6 armadillo repeat containing, X-linked 6 2 4
MIRT592358 Angel1 angel homolog 1 2 2
MIRT592371 4930444A02Rik protein-O-mannose kinase 2 2
MIRT592405 Tacc1 transforming, acidic coiled-coil containing protein 1 2 4
MIRT592434 Spsb4 splA/ryanodine receptor domain and SOCS box containing 4 2 2
MIRT592663 Itgav integrin alpha V 2 2
MIRT592714 Fbxo21 F-box protein 21 2 4
MIRT592809 Bicd1 bicaudal D homolog 1 (Drosophila) 2 6
MIRT597927 Pacsin2 protein kinase C and casein kinase substrate in neurons 2 2 2
MIRT598101 Ncl nucleolin 2 2
MIRT598641 Idua iduronidase, alpha-L- 2 2
MIRT599013 Fgd4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT600260 Trim2 tripartite motif-containing 2 2 2
MIRT600290 Tifab TRAF-interacting protein with forkhead-associated domain, family member B 2 2
MIRT601128 Bri3bp Bri3 binding protein 2 2
MIRT601134 Bcl11b B cell leukemia/lymphoma 11B 2 2
MIRT603790 Lpcat2b lysophosphatidylcholine acyltransferase 2B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated

Error report submission