pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-664 |
Genomic Coordinates | chr1: 185242975 - 185243043 |
Synonyms | mmu-mir-664, Mir664 |
Description | Mus musculus miR-664 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-664-3p |
Sequence | 38| UAUUCAUUUACUCCCCAGCCUA |59 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Aqp3 | ||||||||||||||||||||
Synonyms | AQP-2 | ||||||||||||||||||||
Description | aquaporin 3 | ||||||||||||||||||||
Transcript | NM_016689 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Aqp3 | |||||||||||||||||||||
3'UTR of Aqp3 (miRNA target sites are highlighted) |
>Aqp3|NM_016689|3'UTR 1 GTGGGCAGCAGCCCCCCTCCCCCACTGTGCACTCTCCTGAGTGTCCACTGACTGTGTGGGGACCAGTCCCCGAAAGCCCT 81 TTGTGATGCCTCTCTCGGGCTAAACCGCTCCCTGTGTCCACCCCTGCTGGATGGGCCCTCCAGAATTTCTATGAACTCTG 161 CCCATTAGGGCATTAGGTTCCCACCCACCTTTAAGCCAAGGTAGGATAGCAAATAAGATGGAGAGAGAGAGAGAGAGAGA 241 GAGAGAGAGAGAGAGAGAGAGAGAATGAATGTGTACATGTGTGCTGTTTTCTAAGCTGAATGATGCAAAGGCAAGGGACC 321 AAGTTTTCAAAACAAACTGTAGCAGCTCAGGGGAAGGGAGCCCAGGGGAAGGGAGAAAGTGAGTCAGGAATGTGCCAGAG 401 TGTGCATGCTTCAGGGACTCCTCCATGTGGAGGTGGACCCAGAAGTGAGTTTCTAAGTATGCGTGTGCCTACTGTTTTTT 481 TTTTTTTTTTTGAAATGGACTTCTAGGCTTGGGGAGGGGGAAGGGATAAGAAGGGTGTAGCTCACATCTGGAGCTATGAC 561 CCTTGACTGGGGGCTGTGTAATATGTTTCTGTTATAAGATAGACATTGGGAGGGGCTGAAGTCCAGGTCGTAAGTTTCAT 641 AATTTGTTTTTTAAATATATAAATATATACATACATATATGTTACAGCCCTAGGAATAGGGGTGGGAAACTCCACTTTTT 721 AAAAGGGGTTTCCTTTCTTTAATCCTCCAATCAACAATGTACTGTTGCCTTTTATATATAAAAAAGAATAAAACGTATAC 801 ATGCTACAGG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Liver | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
34 mmu-miR-664-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT577936 | Prl5a1 | prolactin family 5, subfamily a, member 1 | 1 | 1 | ||||||||
MIRT578554 | Hopx | HOP homeobox | 1 | 1 | ||||||||
MIRT579006 | Cyp19a1 | cytochrome P450, family 19, subfamily a, polypeptide 1 | 1 | 1 | ||||||||
MIRT579669 | 1200011I18Rik | GPALPP motifs containing 1 | 1 | 1 | ||||||||
MIRT580267 | Trim12c | tripartite motif-containing 12C | 1 | 1 | ||||||||
MIRT580632 | Sycp2 | synaptonemal complex protein 2 | 1 | 1 | ||||||||
MIRT580981 | Slc12a2 | solute carrier family 12, member 2 | 1 | 1 | ||||||||
MIRT581678 | Ppp1r3d | protein phosphatase 1, regulatory subunit 3D | 1 | 1 | ||||||||
MIRT582092 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | 1 | 1 | ||||||||
MIRT582126 | Nr2c1 | nuclear receptor subfamily 2, group C, member 1 | 1 | 1 | ||||||||
MIRT583126 | Heca | hdc homolog, cell cycle regulator | 1 | 1 | ||||||||
MIRT583594 | Fam78b | family with sequence similarity 78, member B | 1 | 1 | ||||||||
MIRT583662 | Fam160b2 | family with sequence similarity 160, member B2 | 1 | 5 | ||||||||
MIRT584399 | Cdc27 | cell division cycle 27 | 1 | 1 | ||||||||
MIRT584815 | Arid4b | AT rich interactive domain 4B (RBP1-like) | 1 | 1 | ||||||||
MIRT585915 | Slc16a9 | solute carrier family 16 (monocarboxylic acid transporters), member 9 | 1 | 1 | ||||||||
MIRT586057 | Rnmt | RNA (guanine-7-) methyltransferase | 1 | 1 | ||||||||
MIRT586080 | Rgs4 | regulator of G-protein signaling 4 | 1 | 1 | ||||||||
MIRT587942 | Atl2 | atlastin GTPase 2 | 1 | 2 | ||||||||
MIRT590595 | Atp2a2 | ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | 1 | 1 | ||||||||
MIRT590735 | Ado | 2-aminoethanethiol (cysteamine) dioxygenase | 1 | 1 | ||||||||
MIRT591492 | Aqp3 | aquaporin 3 | 1 | 2 | ||||||||
MIRT594084 | Scoc | short coiled-coil protein | 1 | 1 | ||||||||
MIRT594733 | Zfp62 | zinc finger protein 62 | 1 | 1 | ||||||||
MIRT595057 | Aldh1l2 | aldehyde dehydrogenase 1 family, member L2 | 1 | 1 | ||||||||
MIRT595113 | Rgs17 | regulator of G-protein signaling 17 | 1 | 1 | ||||||||
MIRT595239 | Rhbdl1 | rhomboid, veinlet-like 1 (Drosophila) | 1 | 1 | ||||||||
MIRT595762 | Otud6b | OTU domain containing 6B | 1 | 1 | ||||||||
MIRT595778 | Mc1r | melanocortin 1 receptor | 1 | 1 | ||||||||
MIRT596728 | Wdr59 | WD repeat domain 59 | 1 | 1 | ||||||||
MIRT598239 | Mlph | melanophilin | 1 | 1 | ||||||||
MIRT600005 | 4930563E22Rik | RIKEN cDNA 4930563E22 gene | 1 | 1 | ||||||||
MIRT602439 | Emx2 | empty spiracles homeobox 2 | 1 | 1 | ||||||||
MIRT736865 | Smad4 | SMAD family member 4 | 4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|