| pre-miRNA Information | |
|---|---|
| pre-miRNA | mmu-mir-433 |
| Genomic Coordinates | chr12: 109591715 - 109591838 |
| Synonyms | Mirn433, mmu-mir-433, Mir433 |
| Description | Mus musculus miR-433 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | mmu-miR-433-3p |
| Sequence | 67| AUCAUGAUGGGCUCCUCGGUGU |88 |
| Evidence | Experimental |
| Experiments | PCR |
| Putative Targets | |
| Gene Information | |
|---|---|
| Gene Symbol | LOC100048884 |
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | Liver | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
||||||
15 mmu-miR-433-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT005344 | Rtl1 | retrotransposon-like 1 |  |
1 | 1 | |||||||
| MIRT577522 | Tirap | toll-interleukin 1 receptor (TIR) domain-containing adaptor protein | |
1 | 1 | |||||||
| MIRT579573 | 4933427D06Rik | RIKEN cDNA 4933427D06 gene | |
1 | 1 | |||||||
| MIRT580107 | Ubr1 | ubiquitin protein ligase E3 component n-recognin 1 | |
1 | 1 | |||||||
| MIRT587336 | Egfr | epidermal growth factor receptor | |
1 | 1 | |||||||
| MIRT588205 | Tmem239 | transmembrane 239 | |
1 | 4 | |||||||
| MIRT592068 | Supt7l | suppressor of Ty 7-like | |
1 | 1 | |||||||
| MIRT592237 | LOC100048884 | major urinary protein 18 | |
1 | 1 | |||||||
| MIRT594062 | Wdr26 | WD repeat domain 26 | |
1 | 1 | |||||||
| MIRT594086 | Scoc | short coiled-coil protein | |
1 | 1 | |||||||
| MIRT594798 | Sgk3 | serum/glucocorticoid regulated kinase 3 | |
1 | 1 | |||||||
| MIRT596398 | Slc16a7 | solute carrier family 16 (monocarboxylic acid transporters), member 7 | |
1 | 1 | |||||||
| MIRT601400 | Utp23 | UTP23 small subunit processome component | |
1 | 1 | |||||||
| MIRT605117 | Colec12 | collectin sub-family member 12 | |
1 | 1 | |||||||
| MIRT606490 | Cln8 | ceroid-lipofuscinosis, neuronal 8 | |
1 | 1 | |||||||
| miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|