miRTarBase - #MIRT592581


—
pre-miRNA Information
pre-miRNA mmu-mir-302a   
Genomic Coordinates chr3: 127545496 - 127545564
Description Mus musculus miR-302a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-302a-3p
Sequence 44| UAAGUGCUUCCAUGUUUUGGUGA |66
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Mup13   
Synonyms Gm13513, Mup11
Description major urinary protein 13
Transcript NM_001134674   
Expression
Putative miRNA Targets on Mup13
3'UTR of Mup13
(miRNA target sites are highlighted)		 
>Mup13|NM_001134674|3'UTR
   1 GAAGTCCAATTCCAGTCTATCCACATGTTACCTAGGATACCTCATCAAGAATCAAAGACTTCTTTAAATTTCTCTTTGAT
  81 ATACCCATGACAATTTTTCATGAATTTCTTCCTCTTCCTGTTCAATAAATGATTACCCTTGCACTTAAAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agugguuuuguaccuuCGUGAAu 5'
                          |||||| 
Target 5' ataaatgattacccttGCACTTa 3'
 125 - 147 120.00 -8.50
2 
miRNA  3' agUGGUUUUGUACCUUCGUGAAu 5'
            |:|||:| ||  ||| |||| 
Target 5' tcATCAAGA-ATCAAAG-ACTTc 3'
 42 - 62 116.00 -9.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated ...

- Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agugguuuuguaccuuCGUGAAu 5'
                          |||||| 
Target 5' auaaaugauuacccuuGCACUUa 3'
 		1 - 23
Article - Schug J; McKenna LB; Walton G; Hand N; et al.
- BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
73 mmu-miR-302a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054363 Lats2 large tumor suppressor 2 4 1
MIRT054577 Ccnd1 cyclin D1 4 1
MIRT578213 Myl6b myosin, light polypeptide 6B 1 1
MIRT579773 Zfp568 zinc finger protein 568 1 1
MIRT579903 Zbtb41 zinc finger and BTB domain containing 41 1 1
MIRT582206 Nfatc3 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 1 1
MIRT589603 Luc7l2 LUC7-like 2 (S. cerevisiae) 1 4
MIRT592531 Mup7 major urinary protein 7 1 1
MIRT592581 Mup13 major urinary protein 13 1 1
MIRT595334 Galnt4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 1 1
MIRT596464 Fam168b family with sequence similarity 168, member B 1 1
MIRT596522 Zfp882 zinc finger protein 882 1 1
MIRT596544 Zfp866 zinc finger protein 866 1 1
MIRT596766 Usp45 ubiquitin specific petidase 45 1 1
MIRT596795 Ubxn2a UBX domain protein 2A 1 1
MIRT596925 Tprkb Tp53rk binding protein 1 1
MIRT597148 Stxbp4 syntaxin binding protein 4 1 1
MIRT597693 Ppp2r3d protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta 1 1
MIRT598003 Npy1r neuropeptide Y receptor Y1 1 1
MIRT598028 Nol10 nucleolar protein 10 1 1
MIRT598114 Ncl nucleolin 1 1
MIRT598150 Mtif2 mitochondrial translational initiation factor 2 1 1
MIRT598303 Mc1r melanocortin 1 receptor 1 1
MIRT598345 Mau2 MAU2 sister chromatid cohesion factor 1 1
MIRT598390 Magt1 magnesium transporter 1 1 1
MIRT598435 Lpl lipoprotein lipase 1 1
MIRT598657 Hpgds hematopoietic prostaglandin D synthase 1 1
MIRT598871 Glyctk glycerate kinase 1 1
MIRT598885 Glrx2 glutaredoxin 2 (thioltransferase) 1 1
MIRT599161 Diap2 diaphanous related formin 2 1 1
MIRT599255 Tmem245 transmembrane protein 245 1 1
MIRT599414 Chek2 checkpoint kinase 2 1 1
MIRT599539 Car5b carbonic anhydrase 5b, mitochondrial 1 1
MIRT599747 Anapc16 anaphase promoting complex subunit 16 1 1
MIRT599850 Adarb1 adenosine deaminase, RNA-specific, B1 1 1
MIRT599896 Acat1 acetyl-Coenzyme A acetyltransferase 1 1 1
MIRT599919 A830018L16Rik RIKEN cDNA A830018L16 gene 1 1
MIRT600228 Trim56 tripartite motif-containing 56 1 1
MIRT600269 Tns4 tensin 4 1 1
MIRT600435 Samd8 sterile alpha motif domain containing 8 1 1
MIRT600863 Gad2 glutamic acid decarboxylase 2 1 1
MIRT600876 Gabpb2 GA repeat binding protein, beta 2 1 1
MIRT600951 Elf1 E74-like factor 1 1 1
MIRT601038 Cntn2 contactin 2 1 1
MIRT601252 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT601369 Ybey ybeY metallopeptidase 1 1
MIRT601493 Tmlhe trimethyllysine hydroxylase, epsilon 1 1
MIRT601936 Ogdh oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT601974 Nav1 neuron navigator 1 1 1
MIRT602014 Mpp7 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) 1 1
MIRT602186 Hyal1 hyaluronoglucosaminidase 1 1 1
MIRT602216 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT602228 H2-T3 histocompatibility 2, T region locus 3 1 1
MIRT602245 Grm1 glutamate receptor, metabotropic 1 1 1
MIRT602367 Fbxl3 F-box and leucine-rich repeat protein 3 1 1
MIRT602425 Ercc4 excision repair cross-complementing rodent repair deficiency, complementation group 4 1 1
MIRT602490 Dkc1 dyskeratosis congenita 1, dyskerin 1 1
MIRT602596 Chrnb4 cholinergic receptor, nicotinic, beta polypeptide 4 1 1
MIRT602684 Camk4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT602761 Asxl2 additional sex combs like 2 (Drosophila) 1 1
MIRT603033 Chic1 cysteine-rich hydrophobic domain 1 1 1
MIRT603526 Pwwp2a PWWP domain containing 2A 1 1
MIRT603813 Kif5b kinesin family member 5B 1 1
MIRT603883 Il10rb interleukin 10 receptor, beta 1 1
MIRT604185 Cxcl11 chemokine (C-X-C motif) ligand 11 1 1
MIRT605161 C030039L03Rik zinc finger protein 607B 1 1
MIRT605480 Slc6a2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 1 1
MIRT605613 Mpv17 MpV17 mitochondrial inner membrane protein 1 1
MIRT605789 Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11 1 1
MIRT605806 Emc8 ER membrane protein complex subunit 8 1 1
MIRT605843 Cd300a CD300A molecule 1 1
MIRT731069 Nr2f2 nuclear receptor subfamily 2, group F, member 2 3 1
MIRT734874 FOXO1 forkhead box O1 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-302a Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-302a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated

Error report submission