pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-186 |
Genomic Coordinates | chr3: 157544279 - 157544349 |
Synonyms | Mirn186, mmu-mir-186, Mir186 |
Description | Mus musculus miR-186 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-186-5p |
Sequence | 7| CAAAGAAUUCUCCUUUUGGGCU |28 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Mmp12 | ||||||||||||||||||||
Synonyms | AV378681, MME, Mmel | ||||||||||||||||||||
Description | matrix metallopeptidase 12 | ||||||||||||||||||||
Transcript | NM_008605 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Mmp12 | |||||||||||||||||||||
3'UTR of Mmp12 (miRNA target sites are highlighted) |
>Mmp12|NM_008605|3'UTR
1 GAAGAATGTAGTGAAGGGTGCTTGCTGGTTTTTCAGTTTTATAAGTATATTTATTACATATTCACTCTATGCTCAGGGTG
81 TAACTATGTGGCAATAATGTAACAGGAAATAAGGGGAGGTGTACAGGTCACACACACATAGTTACACAGAAAAGTGCTTT
161 TACAAAATTAACCTCTTTTAGGAAACTTTTTTCACTTCATTCTATTCTTAATTTTGAAAGTGCATGGTTCAGAGGCCAAC
241 TGGTTTATCTGTAAGTTGTTTTCTAACAACCTTCAAGTAGAAATATTAGAATTACTCTCTTGTCTTTACTGAAATGTAAC
321 ATGTTTTGTTTTCTTTAAATAAATTGAAAGAAAGTGTTTGCCTTTTAATTTTTTCTTTAAAAAAGTGTGTGTGTGTGTGT
401 GTGTGTGTGTGTGTATGT TGCCTATGTGCATATTTATGTACCACCTGCTGGTAGAAGACAGAAGAGGATGTCAGGTCCCT
481 AGAAACAGGAGTTATCATGGTTATGGGAAACATTGTGGGTGCTGGGGATTGAATTCATATCTCCTAAAAGAGCAGCCTGT
561 GCTCTTTGCTCCTGTGTCATCTCTCCAGCCCCAGTTATAATATTTTTCTTGAAAAGTCAATCAATTTTGAAAATAACTGT
641 GGTCTTCTAAATAAAATCTTTCTGTGACTGTACCAAGCCATCAATGGAGATGTGATAGCTATAAGAAGTTGAAGCTTGGA
721 GTCCTTTTAATCACTTGTGTATGAACAGCAGTCTAAACCCAAGACAAGAAAGCATTCTCTAGCCAGCACATGACTCCAAA
801 GGTAGCTCCATATGACCACAAGACTGAAGAGGAGGTAGGAGGAAATAAGGCTTCTGTTCTTGTTAGATGTGTTGTGTGGC
881 TCATTTCACATCAGAAAGTGGGTTGTAGCATTGCTATGTGGCCTTACAGGACATTAAATGGAAGCCTCCTTAAGCACAGG
961 AGGAACTATGAGTAGCACACGCTTTGTTTGTCACAGGAAAAAGACAACATGGTGAGCCTGCCATGTCTGTGTCCTGGTCT
1041 GCCTTCTATCAGTTTTATTTTCTGTCCTGACATCTTGGCTCCCTATCTTCTGTATTGTGTATGCTGTAGAGATCTCAAAG
1121 CTTGTGAGTTTGTGAAGTATGTCCAATGTTAAAACTGACTGGTGTATTGTCCAAGAAACAGAGAACCCTTCATAGCAGAT
1201 TGTCATTCAGGCATTTTTGGAGACTGAAATGAACTGAAATAGGAATGACATGAGGAAAGGGCTCCTTTGCTCCATGTGTC
1281 AGATGTGAGTATTAACCTTCGACATCAACTTCATGAGATCCAGAGTCATGTAAGAGACATGTGAGCACTACTTCAAAGAA
1361 GGTAAATGGTAGGGAGCATTGTCACTCTCAGAGCAGGTGGCAGATCGATGACAGTCCCATCATGGGAAGGACAGCATTTT
1441 GTCCTTAATAGGATAGGTCATTAATTTTGGTTATGAATTTGCATTTCCTGTACATAGTGCTCCTGCTCAAACTATCACCC
1521 ATGGACTTACAGCATACCTTACCACCACCATAGTATTCCACACAACATTGTTTCTGTTCAGGGACCTCATTTCACAGCCA
1601 CAGTAGAGTCACATTAGGCTCACATTCATGTTGATATTCATGCTCTGCACAGTCCTGACACGGGAAAAACATCTGCTTTA
1681 TAGACTGCTGTAAGCCTTTGATTGATTTCTAGAATCTTTATCTTCTCAGTATTAGAGACTGAACCCAGGGCCGTGTGTGT
1761 ACAACAAAGCACGTGACCTTTAAGTTATGTCCTAGCAGTTAAGATTCTGAAAAGGTCATTTTTTCTGCTATTTTTATGCT
1841 GGTGTTTTTGTTACTTTTATGAAAAAAAATATTTGGATTACCCTTTATTTAATCATTCCAGGTGGCATGGCTTTTAGATT
1921 ATTAATTTTAGTGTTGACAGCAAACAGATATTTAAAGCCTTAAATTAATGCTACTATTCTCATAATAATTCTGTCAGCGT
2001 GGATTTTTTCAGGAAATGTATTATTTATATTAAAGTGTTATTTAGCTGACTCAATACCTAAAATATTTTCATAACTTCTG
2081 CTATGGCAAATGTTTCCTGAGACAGAATAACAAATAAAAACTCTTCAAAATCTG
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Brain (Mouse neocortex) |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_BrainA_130_50. RNA binding protein: AGO. Condition:Brain A 2A8 P13 130 KD
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A
HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | CD4+ T cells (C57BL/6) |
Disease | MIMAT0000215 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013576. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013577. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013579. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013595. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Liver |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266287. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 36h
HITS-CLIP data was present in ERR266292. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 48h
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
46 mmu-miR-186-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT577608 | Stxbp4 | syntaxin binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT577884 | Qpct | glutaminyl-peptide cyclotransferase (glutaminyl cyclase) | ![]() |
1 | 1 | |||||||
MIRT578137 | Noc3l | NOC3 like DNA replication regulator | ![]() |
1 | 1 | |||||||
MIRT578249 | Mnat1 | menage a trois 1 | ![]() |
1 | 1 | |||||||
MIRT579147 | Ces2g | carboxylesterase 2G | ![]() |
1 | 1 | |||||||
MIRT579219 | Ccdc138 | coiled-coil domain containing 138 | ![]() |
1 | 1 | |||||||
MIRT579578 | 4933427D06Rik | RIKEN cDNA 4933427D06 gene | ![]() |
1 | 1 | |||||||
MIRT580348 | Tmem33 | transmembrane protein 33 | ![]() |
1 | 1 | |||||||
MIRT580592 | Tbl1xr1 | transducin (beta)-like 1X-linked receptor 1 | ![]() |
1 | 1 | |||||||
MIRT580668 | Stk32a | serine/threonine kinase 32A | ![]() |
1 | 1 | |||||||
MIRT580744 | Srek1 | splicing regulatory glutamine/lysine-rich protein 1 | ![]() |
1 | 1 | |||||||
MIRT580779 | Sp6 | trans-acting transcription factor 6 | ![]() |
1 | 1 | |||||||
MIRT580847 | Sltm | SAFB-like, transcription modulator | ![]() |
1 | 1 | |||||||
MIRT580944 | Slc26a5 | solute carrier family 26, member 5 | ![]() |
1 | 1 | |||||||
MIRT581214 | Samd4 | sterile alpha motif domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT581276 | Rprd2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT581520 | Ptprb | protein tyrosine phosphatase, receptor type, B | ![]() |
1 | 1 | |||||||
MIRT582203 | Nfia | nuclear factor I/A | ![]() |
1 | 1 | |||||||
MIRT582893 | Ildr2 | immunoglobulin-like domain containing receptor 2 | ![]() |
1 | 1 | |||||||
MIRT582996 | Id4 | inhibitor of DNA binding 4 | ![]() |
1 | 1 | |||||||
MIRT583079 | Hnrnpa3 | heterogeneous nuclear ribonucleoprotein A3 | ![]() |
1 | 1 | |||||||
MIRT583125 | Heca | hdc homolog, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT583739 | Epm2aip1 | EPM2A (laforin) interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT584127 | Crispld2 | cysteine-rich secretory protein LCCL domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT584166 | Cpox | coproporphyrinogen oxidase | ![]() |
1 | 1 | |||||||
MIRT584531 | C230081A13Rik | pseudopodium-enriched atypical kinase 1 | ![]() |
1 | 1 | |||||||
MIRT584646 | Bach2 | BTB and CNC homology, basic leucine zipper transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT587978 | Armc1 | armadillo repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT588832 | Sp1 | trans-acting transcription factor 1 | ![]() |
1 | 2 | |||||||
MIRT590758 | Acbd5 | acyl-Coenzyme A binding domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT593146 | Mmp12 | matrix metallopeptidase 12 | ![]() |
1 | 4 | |||||||
MIRT593495 | Gjc3 | gap junction protein, gamma 3 | ![]() |
1 | 1 | |||||||
MIRT594880 | Lrig2 | leucine-rich repeats and immunoglobulin-like domains 2 | ![]() |
1 | 1 | |||||||
MIRT594898 | Ifi204 | interferon activated gene 204 | ![]() |
1 | 1 | |||||||
MIRT594932 | Gdi2 | guanosine diphosphate (GDP) dissociation inhibitor 2 | ![]() |
1 | 1 | |||||||
MIRT594945 | Fmnl2 | formin-like 2 | ![]() |
1 | 1 | |||||||
MIRT595197 | Emc3 | ER membrane protein complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT595343 | Frmd4a | FERM domain containing 4A | ![]() |
1 | 1 | |||||||
MIRT595402 | Arsk | arylsulfatase K | ![]() |
1 | 1 | |||||||
MIRT595430 | A630033H20Rik | RIKEN cDNA A630033H20 gene | ![]() |
1 | 1 | |||||||
MIRT595947 | Nelfa | negative elongation factor complex member A, Whsc2 | ![]() |
1 | 1 | |||||||
MIRT596153 | Opn5 | opsin 5 | ![]() |
1 | 1 | |||||||
MIRT601390 | Utp23 | UTP23 small subunit processome component | ![]() |
1 | 1 | |||||||
MIRT602153 | Intu | inturned planar cell polarity protein | ![]() |
1 | 1 | |||||||
MIRT602577 | Colec12 | collectin sub-family member 12 | ![]() |
1 | 1 | |||||||
MIRT604817 | Nr5a2 | nuclear receptor subfamily 5, group A, member 2 | ![]() |
1 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|