pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-1906-1 |
Genomic Coordinates | chr12: 109544541 - 109544620 |
Description | Mus musculus miR-1906-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | mmu-mir-1906-2 |
Genomic Coordinates | chrX: 88759474 - 88759553 |
Synonyms | mmu-mir-1906, Mir1906 |
Description | Mus musculus miR-1906-2 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-1906 |
Sequence | 48| UGCAGCAGCCUGAGGCAGGGCU |69 |
Evidence | Experimental |
Experiments | Microarray |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Spen | ||||||||||||||||||||
Synonyms | Mint, mKIAA0929 | ||||||||||||||||||||
Description | SPEN homolog, transcriptional regulator (Drosophila) | ||||||||||||||||||||
Transcript | NM_019763 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Spen | |||||||||||||||||||||
3'UTR of Spen (miRNA target sites are highlighted) |
>Spen|NM_019763|3'UTR 1 GGCTCTGAACGGTCGCCACCTCAGGGCATTTTCCTGAGGCTCTGCTGCAAAAAAAAAAAAAAAAATGAACACCGTGGACA 81 ACCCAGCCAGGCAGAGAGGCAGGCTGCCAGGCGCCACCAGCTGCCCCGCCCTTCGGCTGCCCAGCTCCGTGGATAGACCT 161 CCTCTGGGGGTGGTGCTGCTTGTATGTTTACATGAAATTCTCCCAGGACAGACCACCAACCATGGACACAGAGACCTTAG 241 GGGCTGGGCTTCTCTCCGCACATGGAGAACAGGAGCCGGGCCCTGGGATCCTTCTGTTCTGTTAAACAGAACAGAACAGC 321 CTTTGCACTAAATTAGTGACTCGCGCAGTGAACACAGGCTGCGATGCTCTGGACATGTGTGCATGAGCACGCCGTGGACT 401 CTCGTGCAGGACTTGGGACTCGTGCTGAAGCCTTGGGGTCAAGGAACATTTCAGTGGGTTTTTGCCCCATCTCCTCCTCC 481 CGTCCCCTGCTCATGGGACATGTTATCTTTCTTAATTCTCCTGCCGCCGCCGCCACCACCACCACCACCACCACCACCAC 561 CACCTTCAGCTCATCGGATGTACAGTTTACAGTTGAGTAACAGTGAACGGAAGGATTTTCTTTCTTGGTCGGATGTGCAG 641 AACTTGGGATGTGTATATATAAATATATAATATATATAAATATATATAATACTGACTTAAATCAAATTTCCCTGACATAC 721 ATTTTTTTTAATCTGTGCCAAAAATGTGTTTTCAAAGAAAATCTTATTTTCATACTCAAGACTTTGTACCGTCACTCATT 801 TGTATAAGTGCGCTTCGTCACTGCACGGGCCCTGCTCCTGCAACATGGAACTGTCGCGTAGCACCTGTACAAGAGACCCG 881 GCCACTCCACTCCCTCCTGTGACCTGGACCTCTCCCTGACTTCCTAACACTTATTAATTTATGAAACTGTTTTTCTCAGC 961 GCAGTTTTGTTCTGTGTGTCCATTGGATTACAAACTTTATTAAAAAATACAAAACA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | CD4+ T cells (C57BL/6) |
Disease | MIMAT0007872 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013575. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013576. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013581. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013583. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013584. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013586. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013588. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013592. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013593. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013595. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013598. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
CLIP-seq Support 1 for dataset GSM1013575 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep1 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1013576 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep2 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1013581 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep7 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1013583 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep9 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1013584 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep10 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1013586 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep12 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1013588 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep2 |
Location of target site | NM_019763 | 3UTR | GCUGCAAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1013592 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep6 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1013593 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep7 |
Location of target site | NM_019763 | 3UTR | CUGCAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1013594 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep8 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM1013595 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep9 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 12 for dataset GSM1013598 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep12 |
Location of target site | NM_019763 | 3UTR | UGCUGCAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
27 mmu-miR-1906 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT578439 | Irgq | immunity-related GTPase family, Q | 2 | 10 | ||||||||
MIRT578971 | Dhdh | dihydrodiol dehydrogenase (dimeric) | 2 | 4 | ||||||||
MIRT580446 | Tln2 | talin 2 | 2 | 2 | ||||||||
MIRT582494 | Mbtps2 | membrane-bound transcription factor peptidase, site 2 | 2 | 2 | ||||||||
MIRT587588 | Cox15 | cytochrome c oxidase assembly protein 15 | 2 | 2 | ||||||||
MIRT589524 | Mtf1 | metal response element binding transcription factor 1 | 2 | 2 | ||||||||
MIRT591281 | Klc1 | kinesin light chain 1 | 2 | 4 | ||||||||
MIRT591935 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b | 2 | 2 | ||||||||
MIRT592084 | Sorcs2 | sortilin-related VPS10 domain containing receptor 2 | 2 | 2 | ||||||||
MIRT592206 | Mapkap1 | mitogen-activated protein kinase associated protein 1 | 2 | 4 | ||||||||
MIRT592349 | Armcx6 | armadillo repeat containing, X-linked 6 | 2 | 4 | ||||||||
MIRT592351 | Angel1 | angel homolog 1 | 2 | 2 | ||||||||
MIRT592365 | 4930444A02Rik | protein-O-mannose kinase | 2 | 2 | ||||||||
MIRT592427 | Spsb4 | splA/ryanodine receptor domain and SOCS box containing 4 | 2 | 2 | ||||||||
MIRT592671 | Itgav | integrin alpha V | 2 | 2 | ||||||||
MIRT592712 | Fbxo21 | F-box protein 21 | 2 | 4 | ||||||||
MIRT593155 | Itsn1 | intersectin 1 (SH3 domain protein 1A) | 2 | 2 | ||||||||
MIRT593662 | Spen | SPEN homolog, transcriptional regulator (Drosophila) | 2 | 2 | ||||||||
MIRT593976 | Cdc14b | CDC14 cell division cycle 14B | 2 | 2 | ||||||||
MIRT597931 | Pacsin2 | protein kinase C and casein kinase substrate in neurons 2 | 2 | 2 | ||||||||
MIRT597949 | Opa1 | OPA1, mitochondrial dynamin like GTPase | 2 | 2 | ||||||||
MIRT598550 | Isoc1 | isochorismatase domain containing 1 | 2 | 2 | ||||||||
MIRT599017 | Fgd4 | FYVE, RhoGEF and PH domain containing 4 | 2 | 2 | ||||||||
MIRT600307 | Tacc1 | transforming, acidic coiled-coil containing protein 1 | 2 | 2 | ||||||||
MIRT603647 | Otop1 | otopetrin 1 | 2 | 2 | ||||||||
MIRT605000 | Fam168b | family with sequence similarity 168, member B | 2 | 2 | ||||||||
MIRT606275 | Oxsm | 3-oxoacyl-ACP synthase, mitochondrial | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|