pre-miRNA Information
pre-miRNA mmu-mir-5114   
Genomic Coordinates chr19: 44303171 - 44303231
Description Mus musculus miR-5114 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-5114
Sequence 1| ACUGGAGACGGAAGCUGCAAGA |22
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol 1200014J11Rik
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD4+ T cells (C57BL/6)
Disease MIMAT0020622
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM1013576. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013581. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013584. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013585. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013595. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013598. RNA binding protein: AGO2. Condition:CD4+ T cells ...

- Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell.

Article - Loeb GB; Khan AA; Canner D; Hiatt JB; et al.
- Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
CLIP-seq Support 1 for dataset GSM1013576
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep2
Location of target site NM_025818 | 3UTR | AGCCACAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1013581
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep7
Location of target site NM_025818 | 3UTR | CCAGCCACAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1013584
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep10
Location of target site NM_025818 | 3UTR | CCAGCCACAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1013585
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep11
Location of target site NM_025818 | 3UTR | GCCACAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1013594
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep8
Location of target site NM_025818 | 3UTR | AGCCACAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1013595
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep9
Location of target site NM_025818 | 3UTR | AGCCACAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1013598
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep12
Location of target site NM_025818 | 3UTR | GCCACAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
39 mmu-miR-5114 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577166 Madd MAP-kinase activating death domain 2 12
MIRT580377 Tmem206 transmembrane protein 206 2 4
MIRT580729 Srrm4 serine/arginine repetitive matrix 4 2 2
MIRT581165 Sec23ip Sec23 interacting protein 2 2
MIRT581310 Rnf150 ring finger protein 150