pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-129-1 |
Genomic Coordinates | chr6: 29022619 - 29022691 |
Description | Mus musculus miR-129-1 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
pre-miRNA | mmu-mir-129-2 |
Genomic Coordinates | chr2: 94241364 - 94241453 |
Description | Mus musculus miR-129-2 stem-loop |
Comment | The miRNA from the 5' arm of this precursor was verified by cloning in mouse . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-129-5p |
Sequence | 15| CUUUUUGCGGUCUGGGCUUGC |35 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |
---|---|
Gene Symbol | Znrf1 |
Synonyms | B830022L21Rik, Rnf42, Zrfp1, nin283 |