pre-miRNA Information
pre-miRNA mmu-mir-129-1   
Genomic Coordinates chr6: 29022619 - 29022691
Description Mus musculus miR-129-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
pre-miRNA mmu-mir-129-2   
Genomic Coordinates chr2: 94241364 - 94241453
Description Mus musculus miR-129-2 stem-loop
Comment The miRNA from the 5' arm of this precursor was verified by cloning in mouse .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-129-5p
Sequence 15| CUUUUUGCGGUCUGGGCUUGC |35
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Znrf1   
Synonyms B830022L21Rik, Rnf42, Zrfp1, nin283