pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-511 |
Genomic Coordinates | chr2: 14261003 - 14261081 |
Synonyms | Mirn511, mmu-mir-511, Mir511 |
Description | Mus musculus miR-511 stem-loop |
Comment | This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-511-3p |
Sequence | 49| AAUGUGUAGCAAAAGACAGGAU |70 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Ifi204 | ||||||||||||||||||||
Synonyms | Ifi16, p204 | ||||||||||||||||||||
Description | interferon activated gene 204 | ||||||||||||||||||||
Transcript | NM_008329 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Ifi204 | |||||||||||||||||||||
3'UTR of Ifi204 (miRNA target sites are highlighted) |
>Ifi204|NM_008329|3'UTR 1 AGGAAAGCCACTCAACCCAGACTCAGTCGGGAGAACCTCTCTGGAACCATACTTCTGAAAACCTGAATGCCAATGATATT 81 TTTTTGTGGAGATAAGATTCAATTACAGAAAATAAATGTGTATAAGCCTATTGAAATATCAGTCCTATAAAGACCATCTC 161 TTAATTCTAGGAAATGGTGTTTTCTTATATTCTTTACACATTTTCTATATCTAAATTCATTTGTTGTCTCTATAACTTCT 241 ATAACTGTTCAATTTGCAATTTTTATGCCTAAAACTTATAAAAATAAATTCACACAATTTCTGTAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | CD4+ T cells (C57BL/6) | ||||||
Disease | MIMAT0017281 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013593. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
CLIP-seq Support 1 for dataset GSM1013593 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep7 |
Location of target site | NM_008329 | 3UTR | UUAUAUUCUUUACACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1013594 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep8 |
Location of target site | NM_008329 | 3UTR | UAUAUUCUUUACACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
131 mmu-miR-511-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT007042 | Rock2 | Rho-associated coiled-coil containing protein kinase 2 | ![]() |
1 | 1 | |||||||
MIRT410979 | Ado | 2-aminoethanethiol (cysteamine) dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT577699 | Slc28a3 | solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577858 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578125 | Nqo2 | N-ribosyldihydronicotinamide quinone reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578178 | Neu1 | neuraminidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578289 | Mavs | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT578542 | Htr1f | 5-hydroxytryptamine (serotonin) receptor 1F | ![]() |
![]() |
2 | 2 | ||||||
MIRT578630 | Gtf2h2 | general transcription factor II H, polypeptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578655 | Gramd1c | GRAM domain containing 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT578681 | Golt1a | golgi transport 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT578805 | Folh1 | folate hydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578909 | Entpd1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579078 | Cox15 | cytochrome c oxidase assembly protein 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579092 | Cnih3 | cornichon family AMPA receptor auxiliary protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579359 | Aplnr | apelin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT579390 | Alkbh1 | alkB homolog 1, histone H2A dioxygenase | ![]() |
![]() |
2 | 6 | ||||||
MIRT579984 | Wnt7a | wingless-type MMTV integration site family, member 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT580016 | Whsc1l1 | nuclear receptor binding SET domain protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT580121 | Ubn2 | ubinuclein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580264 | Trim12c | tripartite motif-containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT580360 | Tmem26 | transmembrane protein 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580400 | Tmem170b | transmembrane protein 170B | ![]() |
![]() |
2 | 2 | ||||||
MIRT580449 | Tln2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580833 | Smarca2 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580872 | Slc7a11 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581115 | Sept3 | septin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581330 | Rgs8 | regulator of G-protein signaling 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581475 | Rabgap1 | RAB GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581599 | Prkcd | protein kinase C, delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT581810 | Plag1 | pleiomorphic adenoma gene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581916 | Pgm3 | phosphoglucomutase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582067 | Onecut2 | one cut domain, family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582557 | Mal2 | mal, T cell differentiation protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582599 | Lrrc40 | leucine rich repeat containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582756 | Klf8 | Kruppel-like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582969 | Igf2 | insulin-like growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT583021 | Htt | huntingtin | ![]() |
![]() |
2 | 2 | ||||||
MIRT583256 | Gnb4 | guanine nucleotide binding protein (G protein), beta 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT583615 | Fam46a | family with sequence similarity 46, member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT583904 | Drp2 | dystrophin related protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584439 | Ccdc85a | coiled-coil domain containing 85A | ![]() |
![]() |
2 | 2 | ||||||
MIRT584855 | Appl1 | adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585490 | Txlnb | taxilin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT585697 | Tbc1d24 | TBC1 domain family, member 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585737 | Steap2 | six transmembrane epithelial antigen of prostate 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585876 | Slc22a8 | solute carrier family 22 (organic anion transporter), member 8 | ![]() |
![]() |
2 | 8 | ||||||
MIRT585961 | Sike1 | suppressor of IKBKE 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT586179 | Ptprr | protein tyrosine phosphatase, receptor type, R | ![]() |
![]() |
2 | 2 | ||||||
MIRT586592 | Mrgpre | MAS-related GPR, member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT586808 | Ints8 | integrator complex subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586916 | Heatr2 | dynein, axonemal assembly factor 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT586949 | Gstt3 | glutathione S-transferase, theta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587148 | Gcnt4 | glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase) | ![]() |
![]() |
2 | 2 | ||||||
MIRT587226 | Nxpe3 | neurexophilin and PC-esterase domain family, member 3 | ![]() |
1 | 1 | |||||||
MIRT587477 | D630045J12Rik | RIKEN cDNA D630045J12 gene | ![]() |
![]() |
2 | 8 | ||||||
MIRT587487 | D630003M21Rik | RIKEN cDNA D630003M21 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT587601 | Cml2 | N-acetyltransferase 8 (GCN5-related) family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587746 | Cd28 | CD28 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT587777 | Ccpg1 | cell cycle progression 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587838 | Casp8 | caspase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT588179 | A530054K11Rik | zinc finger protein 729a | ![]() |
![]() |
2 | 2 | ||||||
MIRT588286 | 1700019G17Rik | N-acetyltransferase 8 (GCN5-related) family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588363 | Zfp518b | zinc finger protein 518B | ![]() |
![]() |
2 | 2 | ||||||
MIRT588390 | Zeb2 | zinc finger E-box binding homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588545 | Uhrf1bp1l | UHRF1 (ICBP90) binding protein 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT588613 | Tsc22d3 | TSC22 domain family, member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588648 | Tmem200a | transmembrane protein 200A | ![]() |
![]() |
2 | 2 | ||||||
MIRT588722 | Tbx22 | T-box 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589666 | Lcorl | ligand dependent nuclear receptor corepressor-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT589865 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589974 | Gabpb2 | GA repeat binding protein, beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590191 | Ell2 | elongation factor RNA polymerase II 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590365 | Clca2 | chloride channel accessory 3A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590839 | Wdr46 | WD repeat domain 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590855 | Vps33b | vacuolar protein sorting 33B | ![]() |
![]() |
2 | 4 | ||||||
MIRT590931 | Supt7l | suppressor of Ty 7-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT591032 | Rfx3 | regulatory factor X, 3 (influences HLA class II expression) | ![]() |
![]() |
2 | 2 | ||||||
MIRT591224 | Ly96 | lymphocyte antigen 96 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591305 | Il18r1 | interleukin 18 receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591362 | Egfl6 | EGF-like-domain, multiple 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591431 | Car10 | carbonic anhydrase 10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591524 | Abcc9 | ATP-binding cassette, sub-family C (CFTR/MRP), member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591574 | Zfhx3 | zinc finger homeobox 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591596 | Xrcc3 | X-ray repair complementing defective repair in Chinese hamster cells 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591612 | Vps37a | vacuolar protein sorting 37A | ![]() |
![]() |
2 | 2 | ||||||
MIRT591706 | Rpusd2 | RNA pseudouridylate synthase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591719 | Rorb | RAR-related orphan receptor beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT591738 | Rab9b | RAB9B, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT591833 | Lin7a | lin-7 homolog A (C. elegans) | ![]() |
![]() |
2 | 2 | ||||||
MIRT591845 | Iglon5 | IgLON family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591896 | Fbrs | fibrosin | ![]() |
![]() |
2 | 2 | ||||||
MIRT591953 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592281 | Gatc | glutamyl-tRNA(Gln) amidotransferase, subunit C | ![]() |
![]() |
2 | 2 | ||||||
MIRT592403 | Tmco1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592457 | Ski | ski sarcoma viral oncogene homolog (avian) | ![]() |
![]() |
2 | 2 | ||||||
MIRT592464 | Runx1 | runt related transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592652 | Lifr | leukemia inhibitory factor receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592681 | Has2 | hyaluronan synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592828 | Asb7 | ankyrin repeat and SOCS box-containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592841 | Akap2 | A kinase (PRKA) anchor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593386 | Adra1b | adrenergic receptor, alpha 1b | ![]() |
![]() |
2 | 2 | ||||||
MIRT593398 | Znrf3 | zinc and ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593410 | Slc6a6 | solute carrier family 6 (neurotransmitter transporter, taurine), member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594175 | Vdr | vitamin D (1,25-dihydroxyvitamin D3) receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT594720 | Zfp931 | zinc finger protein 931 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594897 | Ifi204 | interferon activated gene 204 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594917 | Gm14326 | predicted gene 14326 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594951 | Fblim1 | filamin binding LIM protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT595342 | Frmd4a | FERM domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT595370 | Fam168b | family with sequence similarity 168, member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT595396 | Bcl10 | B cell leukemia/lymphoma 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT595401 | Arsk | arylsulfatase K | ![]() |
![]() |
2 | 2 | ||||||
MIRT595424 | Adamts12 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT595429 | A630033H20Rik | RIKEN cDNA A630033H20 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT595440 | 9030617O03Rik | D-glutamate cyclase | ![]() |
![]() |
2 | 2 | ||||||
MIRT595727 | B2m | beta-2 microglobulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT601791 | Rab27a | RAB27A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT602942 | Xpo7 | exportin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT604983 | Fsd1l | fibronectin type III and SPRY domain containing 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT605311 | Zfp92 | zinc finger protein 92 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605455 | St18 | suppression of tumorigenicity 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605533 | Pstpip2 | proline-serine-threonine phosphatase-interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605596 | Nbeal1 | neurobeachin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605765 | Epas1 | endothelial PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605940 | Sema6a | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT605982 | Mylk4 | myosin light chain kinase family, member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606186 | Slc5a8 | solute carrier family 5 (iodide transporter), member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606235 | Rab3c | RAB3C, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT606619 | Rbfox2 | RNA binding protein, fox-1 homolog (C. elegans) 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT755997 | Tlr4 | toll-like receptor 4 | 3 | 1 |