pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-466e |
Genomic Coordinates | chr2: 10479088 - 10479171 |
Synonyms | mmu-mir-466e, Mir466e |
Description | Mus musculus miR-466e stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-466e-5p |
Sequence | 12| GAUGUGUGUGUACAUGUACAUA |33 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Gm14326 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | predicted gene 14326 | ||||||||||||||||||||
Transcript | NM_001190302 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Gm14326 | |||||||||||||||||||||
3'UTR of Gm14326 (miRNA target sites are highlighted) |
>Gm14326|NM_001190302|3'UTR 1 TATGGTAAAGCCTTTGCAGGAAGCAGTGGTCTCCAATGCCATAAAAGATAAATACAGGAGAGACACCATATGAATGTAAC 81 CAAGGTGGTAAACCCTTTGAAGGAAGCAGTGGTCTTGAATATTATAATCGAAAACACACAGCTGAAAAACCCAGGAATGT 161 AACCAATGTGGTAAAGCCTTTGCAGGAAGGAGTGACCTTTAAAGAGAAAAGACCATACAGGAGAGAAATCTATGAAGGTA 241 TCTAATGTTATAAAGCCTTTGCAGCAAGCATTGATCTCCAAGTACATAAATGAACATATACCAGAGAGGAACCTTTTAAA 321 TGTAACCAATGTGGTAAAGCTTTTTCGAAAAACAATAGTCTTTACACACATAAAAGCACATATAGTTGAGAGAAATGCTT 401 TGATTTTAACCAATGTGGTTAAACTTTTTCAAAAAGCAGTAATCAACAAAATCATGAAAGAGCACGTATAGGAGAGAGAT 481 TTTTGAATGTTAGCAATGGTGCTTTTATAGCTTTTTCACAAAGCAGTGGCCTCCAAATATATAAAGGAACACATACAGGA 561 GAGAAACCCTATGAATATTGGCAATGTTTTAAAGCACTTCTACATCACAATCATCTTCAAATCTGTAAGGAACATGAGGT 641 TTTGAGAAATCCTCTGAATAACACCAATTAGGGAAAGCAATTGTACAAAAGAGTCATCCCCAACACAAAAGTATACACAC 721 TAGATAGAAACCCTATGAATATAGGCAATGTGGTAAACATTTTATAAGTCACAGTAGTCTGTAAGAAAAGGAGACACAGT 801 TGAGAAAAACACTATGAAATGAACAAGTGAACAGAGCCTTGTGCATTAAAATCTTCAAATACATAAAAGAAGACATAGAG 881 GTGAGAAATCCGATGTCTACAAGCCATGTGGTATTGCTTTCACTTGTCAGTCATATTCAAAGACAC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | CD4+ T cells (C57BL/6) | ||||||
Disease | MIMAT0004879 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013593. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
CLIP-seq Support 1 for dataset GSM1013593 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep7 |
Location of target site | NM_001190302 | 3UTR | ACAAUAGUCUUUACACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1013594 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep8 |
Location of target site | NM_001190302 | 3UTR | ACAAUAGUCUUUACAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23142080 / GSE41285 |
CLIP-seq Viewer | Link |
145 mmu-miR-466e-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT410978 | Ado | 2-aminoethanethiol (cysteamine) dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT417624 | Lifr | leukemia inhibitory factor receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT432330 | Igf2 | insulin-like growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT577332 | Zfp157 | zinc finger protein 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577683 | Slc39a14 | solute carrier family 39 (zinc transporter), member 14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT577854 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578123 | Nqo2 | N-ribosyldihydronicotinamide quinone reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578174 | Neu1 | neuraminidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578293 | Mavs | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT578540 | Htr1f | 5-hydroxytryptamine (serotonin) receptor 1F | ![]() |
![]() |
2 | 2 | ||||||
MIRT578635 | Gtf2h2 | general transcription factor II H, polypeptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578659 | Gramd1c | GRAM domain containing 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT578883 | Fam107a | family with sequence similarity 107, member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT578911 | Entpd1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579075 | Cox15 | cytochrome c oxidase assembly protein 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579095 | Cnih3 | cornichon family AMPA receptor auxiliary protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579133 | Chrna1 | cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) | ![]() |
![]() |
2 | 2 | ||||||
MIRT579301 | BC021785 | major facilitator superfamily domain containing 4B5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579361 | Aplnr | apelin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT580013 | Whsc1l1 | nuclear receptor binding SET domain protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT580126 | Ubn2 | ubinuclein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580259 | Trim12c | tripartite motif-containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT580358 | Tmem26 | transmembrane protein 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580397 | Tmem170b | transmembrane protein 170B | ![]() |
![]() |
2 | 2 | ||||||
MIRT580836 | Smarca2 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581003 | Six4 | sine oculis-related homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581112 | Sept3 | septin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581333 | Rgs8 | regulator of G-protein signaling 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581426 | Rasal2 | RAS protein activator like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581434 | Rasa2 | RAS p21 protein activator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581473 | Rabgap1 | RAB GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581601 | Prkcd | protein kinase C, delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT581808 | Plag1 | pleiomorphic adenoma gene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581914 | Pgm3 | phosphoglucomutase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582069 | Onecut2 | one cut domain, family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582600 | Lrrc40 | leucine rich repeat containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582752 | Klf8 | Kruppel-like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583022 | Htt | huntingtin | ![]() |
![]() |
2 | 2 | ||||||
MIRT583260 | Gnb4 | guanine nucleotide binding protein (G protein), beta 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT583313 | Gfod1 | glucose-fructose oxidoreductase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583618 | Fam46a | family with sequence similarity 46, member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT583813 | Eif2s1 | eukaryotic translation initiation factor 2, subunit 1 alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT583908 | Drp2 | dystrophin related protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584442 | Ccdc85a | coiled-coil domain containing 85A | ![]() |
![]() |
2 | 2 | ||||||
MIRT584656 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584859 | Appl1 | adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584912 | Akap10 | A kinase (PRKA) anchor protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585294 | Zfp26 | zinc finger protein 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585429 | Wars2 | tryptophanyl tRNA synthetase 2 (mitochondrial) | ![]() |
![]() |
2 | 2 | ||||||
MIRT585487 | Txlnb | taxilin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT585694 | Tbc1d24 | TBC1 domain family, member 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585739 | Steap2 | six transmembrane epithelial antigen of prostate 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585878 | Slc22a8 | solute carrier family 22 (organic anion transporter), member 8 | ![]() |
![]() |
2 | 8 | ||||||
MIRT585907 | Slc17a5 | solute carrier family 17 (anion/sugar transporter), member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585960 | Sike1 | suppressor of IKBKE 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT586177 | Ptprr | protein tyrosine phosphatase, receptor type, R | ![]() |
![]() |
2 | 2 | ||||||
MIRT586589 | Mrgpre | MAS-related GPR, member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT586806 | Ints8 | integrator complex subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586919 | Heatr2 | dynein, axonemal assembly factor 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT586945 | Gstt3 | glutathione S-transferase, theta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587123 | Gfpt1 | glutamine fructose-6-phosphate transaminase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587151 | Gcnt4 | glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase) | ![]() |
![]() |
2 | 2 | ||||||
MIRT587239 | Nxpe3 | neurexophilin and PC-esterase domain family, member 3 | ![]() |
1 | 1 | |||||||
MIRT587482 | D630045J12Rik | RIKEN cDNA D630045J12 gene | ![]() |
![]() |
2 | 8 | ||||||
MIRT587489 | D630003M21Rik | RIKEN cDNA D630003M21 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT587602 | Cml2 | N-acetyltransferase 8 (GCN5-related) family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587664 | Cdk7 | cyclin-dependent kinase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587741 | Cd28 | CD28 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT587752 | Cd200r1 | CD200 receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587775 | Ccpg1 | cell cycle progression 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587839 | Casp8 | caspase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT587959 | Asah2 | N-acylsphingosine amidohydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588288 | 1700019G17Rik | N-acetyltransferase 8 (GCN5-related) family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588355 | Zfp518b | zinc finger protein 518B | ![]() |
![]() |
2 | 2 | ||||||
MIRT588392 | Zeb2 | zinc finger E-box binding homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588548 | Uhrf1bp1l | UHRF1 (ICBP90) binding protein 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT588604 | Tsc22d3 | TSC22 domain family, member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588726 | Tbx22 | T-box 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588954 | Scn2a1 | sodium channel, voltage-gated, type II, alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT589780 | Insig2 | insulin induced gene 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT589840 | Hif1an | hypoxia-inducible factor 1, alpha subunit inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT589863 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589975 | Gabpb2 | GA repeat binding protein, beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590188 | Ell2 | elongation factor RNA polymerase II 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590360 | Clca2 | chloride channel accessory 3A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590488 | Calcoco1 | calcium binding and coiled coil domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590659 | Apba1 | amyloid beta (A4) precursor protein binding, family A, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590843 | Wdr46 | WD repeat domain 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590859 | Vps33b | vacuolar protein sorting 33B | ![]() |
![]() |
2 | 4 | ||||||
MIRT590920 | Tacr2 | tachykinin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590936 | Supt7l | suppressor of Ty 7-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT591004 | Sh2d2a | SH2 domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT591018 | Scd3 | stearoyl-coenzyme A desaturase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591037 | Rfx3 | regulatory factor X, 3 (influences HLA class II expression) | ![]() |
![]() |
2 | 2 | ||||||
MIRT591045 | Rassf2 | Ras association (RalGDS/AF-6) domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591136 | Nsun3 | NOL1/NOP2/Sun domain family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591225 | Ly96 | lymphocyte antigen 96 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591308 | Il18r1 | interleukin 18 receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591349 | Flrt1 | fibronectin leucine rich transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591363 | Egfl6 | EGF-like-domain, multiple 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591410 | Cer1 | cerberus 1, DAN family BMP antagonist | ![]() |
![]() |
2 | 2 | ||||||
MIRT591443 | Bcl2 | B cell leukemia/lymphoma 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591521 | Abcc9 | ATP-binding cassette, sub-family C (CFTR/MRP), member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591577 | Zfhx3 | zinc finger homeobox 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591597 | Xrcc3 | X-ray repair complementing defective repair in Chinese hamster cells 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591614 | Vps37a | vacuolar protein sorting 37A | ![]() |
![]() |
2 | 2 | ||||||
MIRT591708 | Rpusd2 | RNA pseudouridylate synthase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591720 | Rorb | RAR-related orphan receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT591740 | Rab9b | RAB9B, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT591815 | Mocs1 | molybdenum cofactor synthesis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591838 | Lin7a | lin-7 homolog A (C. elegans) | ![]() |
![]() |
2 | 2 | ||||||
MIRT591850 | Iglon5 | IgLON family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591897 | Fbrs | fibrosin | ![]() |
![]() |
2 | 2 | ||||||
MIRT591978 | Ap1ar | adaptor-related protein complex 1 associated regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT592164 | Oxtr | oxytocin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592241 | LOC100048884 | major urinary protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592285 | Gatc | glutamyl-tRNA(Gln) amidotransferase, subunit C | ![]() |
![]() |
2 | 2 | ||||||
MIRT592450 | Ski | ski sarcoma viral oncogene homolog (avian) | ![]() |
![]() |
2 | 2 | ||||||
MIRT592466 | Runx1 | runt related transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592683 | Has2 | hyaluronan synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592831 | Asb7 | ankyrin repeat and SOCS box-containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592853 | Akap2 | A kinase (PRKA) anchor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593348 | Tmco1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593391 | Adra1b | adrenergic receptor, alpha 1b | ![]() |
![]() |
2 | 2 | ||||||
MIRT593402 | Znrf3 | zinc and ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593411 | Slc6a6 | solute carrier family 6 (neurotransmitter transporter, taurine), member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593503 | Enpp4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594179 | Vdr | vitamin D (1,25-dihydroxyvitamin D3) receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT594723 | Zfp931 | zinc finger protein 931 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594918 | Gm14326 | predicted gene 14326 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594954 | Fblim1 | filamin binding LIM protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594996 | Tmem245 | transmembrane protein 245 | ![]() |
1 | 1 | |||||||
MIRT595717 | Calcr | calcitonin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT601211 | Arhgef9 | CDC42 guanine nucleotide exchange factor (GEF) 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT604988 | Fsd1l | fibronectin type III and SPRY domain containing 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT605314 | Zfp92 | zinc finger protein 92 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605458 | St18 | suppression of tumorigenicity 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605538 | Pstpip2 | proline-serine-threonine phosphatase-interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605601 | Nbeal1 | neurobeachin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605769 | Epas1 | endothelial PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605937 | Sema6a | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT605986 | Mylk4 | myosin light chain kinase family, member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606188 | Slc5a8 | solute carrier family 5 (iodide transporter), member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606238 | Rab3c | RAB3C, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT606736 | Tacr1 | tachykinin receptor 1 | ![]() |
![]() |
2 | 2 |