pre-miRNA Information
pre-miRNA mmu-mir-466e   
Genomic Coordinates chr2: 10479088 - 10479171
Synonyms mmu-mir-466e, Mir466e
Description Mus musculus miR-466e stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-466e-5p
Sequence 12| GAUGUGUGUGUACAUGUACAUA |33
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Gm14326   
Synonyms -
Description predicted gene 14326
Transcript NM_001190302   
Expression
Putative miRNA Targets on Gm14326
3'UTR of Gm14326
(miRNA target sites are highlighted)
>Gm14326|NM_001190302|3'UTR
   1 TATGGTAAAGCCTTTGCAGGAAGCAGTGGTCTCCAATGCCATAAAAGATAAATACAGGAGAGACACCATATGAATGTAAC
  81 CAAGGTGGTAAACCCTTTGAAGGAAGCAGTGGTCTTGAATATTATAATCGAAAACACACAGCTGAAAAACCCAGGAATGT
 161 AACCAATGTGGTAAAGCCTTTGCAGGAAGGAGTGACCTTTAAAGAGAAAAGACCATACAGGAGAGAAATCTATGAAGGTA
 241 TCTAATGTTATAAAGCCTTTGCAGCAAGCATTGATCTCCAAGTACATAAATGAACATATACCAGAGAGGAACCTTTTAAA
 321 TGTAACCAATGTGGTAAAGCTTTTTCGAAAAACAATAGTCTTTACACACATAAAAGCACATATAGTTGAGAGAAATGCTT
 401 TGATTTTAACCAATGTGGTTAAACTTTTTCAAAAAGCAGTAATCAACAAAATCATGAAAGAGCACGTATAGGAGAGAGAT
 481 TTTTGAATGTTAGCAATGGTGCTTTTATAGCTTTTTCACAAAGCAGTGGCCTCCAAATATATAAAGGAACACATACAGGA
 561 GAGAAACCCTATGAATATTGGCAATGTTTTAAAGCACTTCTACATCACAATCATCTTCAAATCTGTAAGGAACATGAGGT
 641 TTTGAGAAATCCTCTGAATAACACCAATTAGGGAAAGCAATTGTACAAAAGAGTCATCCCCAACACAAAAGTATACACAC
 721 TAGATAGAAACCCTATGAATATAGGCAATGTGGTAAACATTTTATAAGTCACAGTAGTCTGTAAGAAAAGGAGACACAGT
 801 TGAGAAAAACACTATGAAATGAACAAGTGAACAGAGCCTTGTGCATTAAAATCTTCAAATACATAAAAGAAGACATAGAG
 881 GTGAGAAATCCGATGTCTACAAGCCATGTGGTATTGCTTTCACTTGTCAGTCATATTCAAAGACAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' auacAUGUACAUGUGUGUGUAg 5'
              || :| | :|||||||| 
Target 5' acaaTA-GTCTTTACACACATa 3'
352 - 372 153.00 -10.80
2
miRNA  3' auACAUGUA-CAUGUGUGUGUag 5'
            | || || | | |||||||  
Target 5' atTATA-ATCGAAAACACACAgc 3'
121 - 142 135.00 -7.80
3
miRNA  3' auACAUGUACAUGUGUGUGUag 5'
            | || | | |||||:|||  
Target 5' taTATAAAGGAACACATACAgg 3'
538 - 559 132.00 -10.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD4+ T cells (C57BL/6)
Disease MIMAT0004879
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM1013593. RNA binding protein: AGO2. Condition:CD4+ T cells "HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells ...

- Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' auacaUG-UA-CAUGUGUGUGuag 5'
               || || || : :||||   
Target 5' -----ACAAUAGUCUUUACAC--- 3'
1 - 16
Article - Loeb GB; Khan AA; Canner D; Hiatt JB; et al.
- Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
CLIP-seq Support 1 for dataset GSM1013593
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep7
Location of target site NM_001190302 | 3UTR | ACAAUAGUCUUUACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1013594
Method / RBP HITS-CLIP / AGO2
Cell line / Condition CD4+ T cells (C57BL/6) / CD4+ T cells, WT, biological rep8
Location of target site NM_001190302 | 3UTR | ACAAUAGUCUUUACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23142080 / GSE41285
CLIP-seq Viewer Link
145 mmu-miR-466e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT410978 Ado 2-aminoethanethiol (cysteamine) dioxygenase 2 2
MIRT417624 Lifr leukemia inhibitory factor receptor 2 2
MIRT432330 Igf2 insulin-like growth factor 2 2 4
MIRT577332 Zfp157 zinc finger protein 157 2 2
MIRT577683 Slc39a14 solute carrier family 39 (zinc transporter), member 14 2 6
MIRT577854 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 2 2
MIRT578123 Nqo2 N-ribosyldihydronicotinamide quinone reductase 2 2 2
MIRT578174 Neu1 neuraminidase 1 2 2
MIRT578293 Mavs mitochondrial antiviral signaling protein 2 2
MIRT578540 Htr1f 5-hydroxytryptamine (serotonin) receptor 1F 2 2
MIRT578635 Gtf2h2 general transcription factor II H, polypeptide 2 2 2
MIRT578659 Gramd1c GRAM domain containing 1C 2 2
MIRT578883 Fam107a family with sequence similarity 107, member A 2 6
MIRT578911 Entpd1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT579075 Cox15 cytochrome c oxidase assembly protein 15 2 4
MIRT579095 Cnih3 cornichon family AMPA receptor auxiliary protein 3 2 4
MIRT579133 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT579301 BC021785 major facilitator superfamily domain containing 4B5 2 2
MIRT579361 Aplnr apelin receptor 2 2
MIRT580013 Whsc1l1 nuclear receptor binding SET domain protein 3 2 4
MIRT580126 Ubn2 ubinuclein 2 2 2
MIRT580259 Trim12c tripartite motif-containing 12C 2 2
MIRT580358 Tmem26 transmembrane protein 26 2 2
MIRT580397 Tmem170b transmembrane protein 170B 2 2
MIRT580836 Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 2 2
MIRT581003 Six4 sine oculis-related homeobox 4 2 2
MIRT581112 Sept3 septin 3 2 2
MIRT581333 Rgs8 regulator of G-protein signaling 8 2 2
MIRT581426 Rasal2 RAS protein activator like 2 2 2
MIRT581434 Rasa2 RAS p21 protein activator 2 2 2
MIRT581473 Rabgap1 RAB GTPase activating protein 1 2 2
MIRT581601 Prkcd protein kinase C, delta 2 2
MIRT581808 Plag1 pleiomorphic adenoma gene 1 2 2
MIRT581914 Pgm3 phosphoglucomutase 3 2 2
MIRT582069 Onecut2 one cut domain, family member 2 2 2
MIRT582600 Lrrc40 leucine rich repeat containing 40 2 2
MIRT582752 Klf8 Kruppel-like factor 8 2 2
MIRT583022 Htt huntingtin 2 2
MIRT583260 Gnb4 guanine nucleotide binding protein (G protein), beta 4 2 4
MIRT583313 Gfod1 glucose-fructose oxidoreductase domain containing 1 2 2
MIRT583618 Fam46a family with sequence similarity 46, member A 2 2
MIRT583813 Eif2s1 eukaryotic translation initiation factor 2, subunit 1 alpha 2 2
MIRT583908 Drp2 dystrophin related protein 2 2 2
MIRT584442 Ccdc85a coiled-coil domain containing 85A 2 2
MIRT584656 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 2 2
MIRT584859 Appl1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 2 2
MIRT584912 Akap10 A kinase (PRKA) anchor protein 10 2 2
MIRT585294 Zfp26 zinc finger protein 26 2 2
MIRT585429 Wars2 tryptophanyl tRNA synthetase 2 (mitochondrial) 2 2
MIRT585487 Txlnb taxilin beta 2 2
MIRT585694 Tbc1d24 TBC1 domain family, member 24 2 2
MIRT585739 Steap2 six transmembrane epithelial antigen of prostate 2 2 2
MIRT585878 Slc22a8 solute carrier family 22 (organic anion transporter), member 8 2 8
MIRT585907 Slc17a5 solute carrier family 17 (anion/sugar transporter), member 5 2 2
MIRT585960 Sike1 suppressor of IKBKE 1 2 6
MIRT586177 Ptprr protein tyrosine phosphatase, receptor type, R 2 2
MIRT586589 Mrgpre MAS-related GPR, member E 2 2
MIRT586806 Ints8 integrator complex subunit 8 2 2
MIRT586919 Heatr2 dynein, axonemal assembly factor 5 2 4
MIRT586945 Gstt3 glutathione S-transferase, theta 3 2 2
MIRT587123 Gfpt1 glutamine fructose-6-phosphate transaminase 1 2 2
MIRT587151 Gcnt4 glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase) 2 2
MIRT587239 Nxpe3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT587482 D630045J12Rik RIKEN cDNA D630045J12 gene 2 8
MIRT587489 D630003M21Rik RIKEN cDNA D630003M21 gene 2 2
MIRT587602 Cml2 N-acetyltransferase 8 (GCN5-related) family member 2 2 2
MIRT587664 Cdk7 cyclin-dependent kinase 7 2 2
MIRT587741 Cd28 CD28 antigen 2 2
MIRT587752 Cd200r1 CD200 receptor 1 2 2
MIRT587775 Ccpg1 cell cycle progression 1 2 2
MIRT587839 Casp8 caspase 8 2 4
MIRT587959 Asah2 N-acylsphingosine amidohydrolase 2 2 2
MIRT588288 1700019G17Rik N-acetyltransferase 8 (GCN5-related) family member 4 2 2
MIRT588355 Zfp518b zinc finger protein 518B 2 2
MIRT588392 Zeb2 zinc finger E-box binding homeobox 2 2 2
MIRT588548 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 2 2
MIRT588604 Tsc22d3 TSC22 domain family, member 3 2 2
MIRT588726 Tbx22 T-box 22 2 2
MIRT588954 Scn2a1 sodium channel, voltage-gated, type II, alpha 2 2
MIRT589780 Insig2 insulin induced gene 2 2 4
MIRT589840 Hif1an hypoxia-inducible factor 1, alpha subunit inhibitor 2 2
MIRT589863 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT589975 Gabpb2 GA repeat binding protein, beta 2 2 2
MIRT590188 Ell2 elongation factor RNA polymerase II 2 2 2
MIRT590360 Clca2 chloride channel accessory 3A2 2 2
MIRT590488 Calcoco1 calcium binding and coiled coil domain 1 2 2
MIRT590659 Apba1 amyloid beta (A4) precursor protein binding, family A, member 1 2 2
MIRT590843 Wdr46 WD repeat domain 46 2 2
MIRT590859 Vps33b vacuolar protein sorting 33B 2 4
MIRT590920 Tacr2 tachykinin receptor 2 2 2
MIRT590936 Supt7l suppressor of Ty 7-like 2 2
MIRT591004 Sh2d2a SH2 domain containing 2A 2 2
MIRT591018 Scd3 stearoyl-coenzyme A desaturase 3 2 2
MIRT591037 Rfx3 regulatory factor X, 3 (influences HLA class II expression) 2 2
MIRT591045 Rassf2 Ras association (RalGDS/AF-6) domain family member 2 2 2
MIRT591136 Nsun3 NOL1/NOP2/Sun domain family member 3 2 2
MIRT591225 Ly96 lymphocyte antigen 96 2 2
MIRT591308 Il18r1 interleukin 18 receptor 1 2 2
MIRT591349 Flrt1 fibronectin leucine rich transmembrane protein 1 2 2
MIRT591363 Egfl6 EGF-like-domain, multiple 6 2 2
MIRT591410 Cer1 cerberus 1, DAN family BMP antagonist 2 2
MIRT591443 Bcl2 B cell leukemia/lymphoma 2 2 2
MIRT591521 Abcc9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 2 2
MIRT591577 Zfhx3 zinc finger homeobox 3 2 4
MIRT591597 Xrcc3 X-ray repair complementing defective repair in Chinese hamster cells 3 2 2
MIRT591614 Vps37a vacuolar protein sorting 37A 2 2
MIRT591708 Rpusd2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT591720 Rorb RAR-related orphan receptor beta 2 2
MIRT591740 Rab9b RAB9B, member RAS oncogene family 2 4
MIRT591815 Mocs1 molybdenum cofactor synthesis 1 2 2
MIRT591838 Lin7a lin-7 homolog A (C. elegans) 2 2
MIRT591850 Iglon5 IgLON family member 5 2 2
MIRT591897 Fbrs fibrosin 2 2
MIRT591978 Ap1ar adaptor-related protein complex 1 associated regulatory protein 2 2
MIRT592164 Oxtr oxytocin receptor 2 2
MIRT592241 LOC100048884 major urinary protein 18 2 2
MIRT592285 Gatc glutamyl-tRNA(Gln) amidotransferase, subunit C 2 2
MIRT592450 Ski ski sarcoma viral oncogene homolog (avian) 2 2
MIRT592466 Runx1 runt related transcription factor 1 2 2
MIRT592683 Has2 hyaluronan synthase 2 2 2
MIRT592831 Asb7 ankyrin repeat and SOCS box-containing 7 2 2
MIRT592853 Akap2 A kinase (PRKA) anchor protein 2 2 2
MIRT593348 Tmco1 transmembrane and coiled-coil domains 1 2 2
MIRT593391 Adra1b adrenergic receptor, alpha 1b 2 2
MIRT593402 Znrf3 zinc and ring finger 3 2 2
MIRT593411 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 2 2
MIRT593503 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 2 2
MIRT594179 Vdr vitamin D (1,25-dihydroxyvitamin D3) receptor 2 2
MIRT594723 Zfp931 zinc finger protein 931 2 2
MIRT594918 Gm14326 predicted gene 14326 2 2
MIRT594954 Fblim1 filamin binding LIM protein 1 2 2
MIRT594996 Tmem245 transmembrane protein 245 1 1
MIRT595717 Calcr calcitonin receptor 2 2
MIRT601211 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 2 2
MIRT604988 Fsd1l fibronectin type III and SPRY domain containing 1-like 2 2
MIRT605314 Zfp92 zinc finger protein 92 2 2
MIRT605458 St18 suppression of tumorigenicity 18 2 2
MIRT605538 Pstpip2 proline-serine-threonine phosphatase-interacting protein 2 2 2
MIRT605601 Nbeal1 neurobeachin like 1 2 2
MIRT605769 Epas1 endothelial PAS domain protein 1 2 2
MIRT605937 Sema6a sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 2 2
MIRT605986 Mylk4 myosin light chain kinase family, member 4 2 2
MIRT606188 Slc5a8 solute carrier family 5 (iodide transporter), member 8 2 2
MIRT606238 Rab3c RAB3C, member RAS oncogene family 2 2
MIRT606736 Tacr1 tachykinin receptor 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-466e-5p Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated

Error report submission