pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-664 |
Genomic Coordinates | chr1: 185242975 - 185243043 |
Synonyms | mmu-mir-664, Mir664 |
Description | Mus musculus miR-664 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-664-3p |
Sequence | 38| UAUUCAUUUACUCCCCAGCCUA |59 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Rhbdl1 | ||||||||||||||||||||
Synonyms | Rhbdl | ||||||||||||||||||||
Description | rhomboid, veinlet-like 1 (Drosophila) | ||||||||||||||||||||
Transcript | NM_144816 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Rhbdl1 | |||||||||||||||||||||
3'UTR of Rhbdl1 (miRNA target sites are highlighted) |
>Rhbdl1|NM_144816|3'UTR 1 CCTGCTCCCTAGGGCCATGTGGCTAGAGCCAGGCACCAGGTGGGCCTGCATGTCTGCCCTATATGAATGGACCTCTCGGC 81 TGCTTTTCCCCACAGGGGCAGGGGGGCCCTGTGATCCCCCACCCCCAGCTGAAGCCAAGTCTTACTGCAGCCCTTGCTGC 161 ACCCCCCCCCCCCAGGCTTTCCAGGGGGAGGGGTGTTACTGGGCCAGGGCTGGGTGGAGGACCTTGAGCGTGGCCCTAGA 241 GGAGACCCCTTCCCTCCCCACTGACCCCAGGACTTGCAGTCTGAGCCTTTTTGGAGAATGAATAAATATTTTACACAGCA 321 AAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | CD4+ T cells (C57BL/6) |
Disease | MIMAT0012774 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013593. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
34 mmu-miR-664-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT577936 | Prl5a1 | prolactin family 5, subfamily a, member 1 | 1 | 1 | ||||||||
MIRT578554 | Hopx | HOP homeobox | 1 | 1 | ||||||||
MIRT579006 | Cyp19a1 | cytochrome P450, family 19, subfamily a, polypeptide 1 | 1 | 1 | ||||||||
MIRT579669 | 1200011I18Rik | GPALPP motifs containing 1 | 1 | 1 | ||||||||
MIRT580267 | Trim12c | tripartite motif-containing 12C | 1 | 1 | ||||||||
MIRT580632 | Sycp2 | synaptonemal complex protein 2 | 1 | 1 | ||||||||
MIRT580981 | Slc12a2 | solute carrier family 12, member 2 | 1 | 1 | ||||||||
MIRT581678 | Ppp1r3d | protein phosphatase 1, regulatory subunit 3D | 1 | 1 | ||||||||
MIRT582092 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | 1 | 1 | ||||||||
MIRT582126 | Nr2c1 | nuclear receptor subfamily 2, group C, member 1 | 1 | 1 | ||||||||
MIRT583126 | Heca | hdc homolog, cell cycle regulator | 1 | 1 | ||||||||
MIRT583594 | Fam78b | family with sequence similarity 78, member B | 1 | 1 | ||||||||
MIRT583662 | Fam160b2 | family with sequence similarity 160, member B2 | 1 | 5 | ||||||||
MIRT584399 | Cdc27 | cell division cycle 27 | 1 | 1 | ||||||||
MIRT584815 | Arid4b | AT rich interactive domain 4B (RBP1-like) | 1 | 1 | ||||||||
MIRT585915 | Slc16a9 | solute carrier family 16 (monocarboxylic acid transporters), member 9 | 1 | 1 | ||||||||
MIRT586057 | Rnmt | RNA (guanine-7-) methyltransferase | 1 | 1 | ||||||||
MIRT586080 | Rgs4 | regulator of G-protein signaling 4 | 1 | 1 | ||||||||
MIRT587942 | Atl2 | atlastin GTPase 2 | 1 | 2 | ||||||||
MIRT590595 | Atp2a2 | ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | 1 | 1 | ||||||||
MIRT590735 | Ado | 2-aminoethanethiol (cysteamine) dioxygenase | 1 | 1 | ||||||||
MIRT591492 | Aqp3 | aquaporin 3 | 1 | 2 | ||||||||
MIRT594084 | Scoc | short coiled-coil protein | 1 | 1 | ||||||||
MIRT594733 | Zfp62 | zinc finger protein 62 | 1 | 1 | ||||||||
MIRT595057 | Aldh1l2 | aldehyde dehydrogenase 1 family, member L2 | 1 | 1 | ||||||||
MIRT595113 | Rgs17 | regulator of G-protein signaling 17 | 1 | 1 | ||||||||
MIRT595239 | Rhbdl1 | rhomboid, veinlet-like 1 (Drosophila) | 1 | 1 | ||||||||
MIRT595762 | Otud6b | OTU domain containing 6B | 1 | 1 | ||||||||
MIRT595778 | Mc1r | melanocortin 1 receptor | 1 | 1 | ||||||||
MIRT596728 | Wdr59 | WD repeat domain 59 | 1 | 1 | ||||||||
MIRT598239 | Mlph | melanophilin | 1 | 1 | ||||||||
MIRT600005 | 4930563E22Rik | RIKEN cDNA 4930563E22 gene | 1 | 1 | ||||||||
MIRT602439 | Emx2 | empty spiracles homeobox 2 | 1 | 1 | ||||||||
MIRT736865 | Smad4 | SMAD family member 4 | 4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|