miRTarBase - #MIRT595895


—
pre-miRNA Information
pre-miRNA mmu-mir-344d-1   
Genomic Coordinates chr7: 61683124 - 61683192
Description Mus musculus miR-344d-1 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al .
RNA Secondary Structure
pre-miRNA mmu-mir-344d-2   
Genomic Coordinates chr7: 61685272 - 61685351
Description Mus musculus miR-344d-2 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al .
RNA Secondary Structure
pre-miRNA mmu-mir-344d-3   
Genomic Coordinates chr7: 61726249 - 61726328
Description Mus musculus miR-344d-3 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-344d-3p
Sequence 45| GAUAUAACCACUGCCAGACUGA |66
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Cd69   
Synonyms 5830438K24Rik, AI452015, AIM, VEA
Description CD69 antigen
Transcript NM_001033122   
Expression
Putative miRNA Targets on Cd69
3'UTR of Cd69
(miRNA target sites are highlighted)		 
>Cd69|NM_001033122|3'UTR
   1 CGAGGATACATAGATGTATAAATGACTGTGCCATAGCACCACAGGAAAGTTGTGTAACTGGATACTGCTCTGCAGTTGAA
  81 TTTTCCACAAAGACTGCACAAACCAACTTTACATCATCCTGGATCAACTCCAGATAGAACTGTGGGACATGAGGAAGAAG
 161 ATCCAGGAAGATCCCTTGACCAGGAGCTGAAACTGTCACCAACTGACTGCTAATCACATCAAGGATGAGAGGATGGCTAT
 241 GAAGCCTCATCAACGCACTTTATTTTTTTTTAAACCTAGAATGAATAGAACTGACTAGCTCTAGAGTTACTATTTATTGC
 321 CGAATGACTGCTACAGCCAGTGCCTTTACGCATTTGCACTATTTGGAGGGGTTTCAGTGGTAGGAAGAGCTGAATGTAGG
 401 TACAGGAAGATTTGACTGATTAATGATTTTCTTAAATTCAAAAAGCATTCACAAATAGAACAATGCTTATGAAACCAAGC
 481 TTTGCAGTAACTCCATCTATTTACAGAAACTTTGCCTCATTATTTTGTCAATTGTTCTCCCCCAAAGAATAAGAGTGGCC
 561 TTTTCTTTAACTTCCTCCGTGTAGACAGCTAATTTTCAATGGTACATATTTCTTAACCTTTAAAAACCTCTGTAGCGTAT
 641 TTCAAGGAAGAAAACAAAAGCACAGCATATGAGTAATATTTGTAGAGCAGATTTCAAAGTGCTGGAAAGAAAAGTGCAAT
 721 ACGTGTAGTGGCAGATCTCTGTCAGGACACACCCTGTGGTTTGACCTTGGAATAACTCCAGTCTTGTCACATAACCTGTT
 801 TGTGTCTTTCCCAGTCCTTTGTCCAAAATATTTCCCATGTGCAATAAAGTGTTTATATATTTGTTTGTGTTTTAAAACCC
 881 ACTATAAAGTTTAAGCTGTTTCTATGTATGTGAAAATAAAAGAATAGATAAATGGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucagaccgUCACCAAUAUAg 5'
                    |||| |||||| 
Target 5' tgtgcaataaAGTGTTTATATa 3'
 838 - 859 128.00 -6.50
2 
miRNA  3' agucaGACCGUCACCAAUAUAg 5'
               | || |   |||:|:| 
Target 5' caccaCAGGAA--AGTTGTGTa 3'
 37 - 56 109.00 -7.20
3 
miRNA  3' agucAGACCGUCACCAAUAUAg 5'
              ||| |||   |||: || 
Target 5' ctgcTCT-GCA---GTTGAATt 3'
 65 - 82 102.00 -5.17
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD4+ T cells (C57BL/6)
Disease MIMAT0014808
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM1013587. RNA binding protein: AGO2. Condition:CD4+ T cells ...

- Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell.

Article - Loeb GB; Khan AA; Canner D; Hiatt JB; et al.
- Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
151 mmu-miR-344d-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT411457 Timp3 tissue inhibitor of metalloproteinase 3 1 1
MIRT429040 Nfib nuclear factor I/B 1 1
MIRT577364 Zbed6 zinc finger, BED type containing 6 1 1
MIRT577414 Ugt2b35 UDP glucuronosyltransferase 2 family, polypeptide B35 1 1
MIRT577446 Ttc17 tetratricopeptide repeat domain 17 1 1
MIRT577510 Tmem100 transmembrane protein 100 1 1
MIRT577584 Tcf21 transcription factor 21 1 1
MIRT577728 Slc12a8 solute carrier family 12 (potassium/chloride transporters), member 8 1 1
MIRT577751 Shh sonic hedgehog 1 1
MIRT577867 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT577938 Ppp6r1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT577948 Pou4f2 POU domain, class 4, transcription factor 2 1 1
MIRT577957 Pm20d2 peptidase M20 domain containing 2 1 1
MIRT578019 Pfkl phosphofructokinase, liver, B-type 1 2
MIRT578051 Pcdhb17 protocadherin beta 17 1 1
MIRT578198 Nadsyn1 NAD synthetase 1 1 1
MIRT578516 Igfbp3 insulin-like growth factor binding protein 3 1 1
MIRT578556 Hopx HOP homeobox 1 1
MIRT578585 Hist1h1d histone cluster 1, H1d 1 1
MIRT578725 Gm8369 predicted gene 8369 1 1
MIRT578807 Folh1 folate hydrolase 1 1 1
MIRT578869 Fam151b family with sequence similarity 151, member B 1 1
MIRT579021 Ctxn3 cortexin 3 1 1
MIRT579051 Crp C-reactive protein, pentraxin-related 1 1
MIRT579404 Akna AT-hook transcription factor 1 1
MIRT579629 Mettl20 electron transfer flavoprotein beta subunit lysine methyltransferase 1 1
MIRT579672 1200011I18Rik GPALPP motifs containing 1 1 1
MIRT579704 Zmynd8 zinc finger, MYND-type containing 8 1 1
MIRT579747 Zfp644 zinc finger protein 644 1 1
MIRT579787 Zfp384 zinc finger protein 384 1 1
MIRT579806 Zfp148 zinc finger protein 148 1 1
MIRT579835 Zfand5 zinc finger, AN1-type domain 5 1 1
MIRT579837 Zer1 zyg-11 related, cell cycle regulator 1 1
MIRT579859 Zc3hav1l zinc finger CCCH-type, antiviral 1-like 1 1
MIRT579994 Wnt3 wingless-type MMTV integration site family, member 3 1 1
MIRT580000 Wnt11 wingless-type MMTV integration site family, member 11 1 1
MIRT580022 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT580091 Usp6nl USP6 N-terminal like 1 1
MIRT580213 Ttc39b tetratricopeptide repeat domain 39B 1 1
MIRT580238 Trps1 transcriptional repressor GATA binding 1 1 1
MIRT580242 Trpc7 transient receptor potential cation channel, subfamily C, member 7 1 1
MIRT580413 Tmem161b transmembrane protein 161B 1 1
MIRT580507 Tfam transcription factor A, mitochondrial 1 1
MIRT580532 Tead3 TEA domain family member 3 1 1
MIRT580553 Tcf7l2 transcription factor 7 like 2, T cell specific, HMG box 1 1
MIRT580566 Tbx4 T-box 4 1 1
MIRT580614 Syp synaptophysin 1 1
MIRT580667 Strbp spermatid perinuclear RNA binding protein 1 1
MIRT580795 Snx27 sorting nexin family member 27 1 1
MIRT580821 Smurf2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT580866 Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 1
MIRT580881 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 1 1
MIRT580921 Slc35a1 solute carrier family 35 (CMP-sialic acid transporter), member 1 1 1
MIRT581143 Senp3 SUMO/sentrin specific peptidase 3 1 1
MIRT581246 Rufy2 RUN and FYVE domain-containing 2 1 1
MIRT581262 Rragb Ras-related GTP binding B 1 1
MIRT581294 Rnf166 ring finger protein 166 1 1
MIRT581353 Ret ret proto-oncogene 1 1
MIRT581391 Rbms3 RNA binding motif, single stranded interacting protein 1 1
MIRT581423 Rasal2 RAS protein activator like 2 1 1
MIRT581454 Ranbp10 RAN binding protein 10 1 1
MIRT581540 Pten phosphatase and tensin homolog 1 1
MIRT581574 Prrx1 paired related homeobox 1 1 1
MIRT581588 Lzts3 leucine zipper, putative tumor suppressor family member 3 1 1
MIRT581664 Ppp4r2 protein phosphatase 4, regulatory subunit 2 1 1
MIRT581739 Plxnc1 plexin C1 1 1
MIRT581792 Plaur plasminogen activator, urokinase receptor 1 1
MIRT581821 Pkib protein kinase inhibitor beta, cAMP dependent, testis specific 1 1
MIRT581895 Phf17 jade family PHD finger 1 1 1
MIRT581983 Pcsk5 proprotein convertase subtilisin/kexin type 5 1 1
MIRT582001 Pcdh20 protocadherin 20 1 1
MIRT582053 Osbp oxysterol binding protein 1 1
MIRT582101 Nupl2 nucleoporin like 2 1 1
MIRT582147 Nol7 nucleolar protein 7 1 1
MIRT582158 Nln neurolysin (metallopeptidase M3 family) 1 1
MIRT582255 Nckap5l NCK-associated protein 5-like 1 1
MIRT582371 Map1a microtubule-associated protein 1 A 1 1
MIRT582409 Mpped2 metallophosphoesterase domain containing 2 1 1
MIRT582441 Mgea5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT582585 Lrrtm2 leucine rich repeat transmembrane neuronal 2 1 1
MIRT582669 Lin54 lin-54 homolog (C. elegans) 1 1
MIRT582720 Larp1 La ribonucleoprotein domain family, member 1 1 1
MIRT582726 L3mbtl4 l(3)mbt-like 4 (Drosophila) 1 2
MIRT582762 Klf12 Kruppel-like factor 12 1 1
MIRT582856 Ism1 isthmin 1, angiogenesis inhibitor 1 1
MIRT582942 Ikzf5 IKAROS family zinc finger 5 1 1
MIRT583000 Id2 inhibitor of DNA binding 2 1 1
MIRT583059 Hoxa11 homeobox A11 1 1
MIRT583102 Hiat1 major facilitator superfamily domain containing 14A 1 1
MIRT583107 Hexim1 hexamethylene bis-acetamide inducible 1 1 1
MIRT583134 Has2 hyaluronan synthase 2 1 1
MIRT583188 Grhl3 grainyhead-like 3 (Drosophila) 1 1
MIRT583230 Gpc6 glypican 6 1 1
MIRT583393 Fzd5 frizzled class receptor 5 1 1
MIRT583412 Fzd1 frizzled class receptor 1 1 1
MIRT583426 Fsd1l fibronectin type III and SPRY domain containing 1-like 1 1
MIRT583526 Fgf16 fibroblast growth factor 16 1 1
MIRT583545 Fbxl20 F-box and leucine-rich repeat protein 20 1 1
MIRT583612 Fam46a family with sequence similarity 46, member A 1 1
MIRT583737 Erc1 ELKS/RAB6-interacting/CAST family member 1 1 3
MIRT583769 Ep300 E1A binding protein p300 1 1
MIRT583795 Elavl4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1
MIRT583816 Eif2s1 eukaryotic translation initiation factor 2, subunit 1 alpha 1 1
MIRT583954 Dlx3 distal-less homeobox 3 1 1
MIRT584137 Crebzf CREB/ATF bZIP transcription factor 1 1
MIRT584209 Cops7b COP9 signalosome subunit 7B 1 1
MIRT584434 Ccdc90b coiled-coil domain containing 90B 1 1
MIRT584452 Cbx3 chromobox 3 1 1
MIRT584465 Casc4 cancer susceptibility candidate 4 1 1
MIRT584507 Calm1 calmodulin 1 1 1
MIRT584733 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT584808 Arl15 ADP-ribosylation factor-like 15 1 1
MIRT584848 Arhgap11a Rho GTPase activating protein 11A 1 1
MIRT584999 Ndnf neuron-derived neurotrophic factor 1 1
MIRT585043 Lrrc71 leucine rich repeat containing 71 1 1
MIRT585731 Synpr synaptoporin 1 1
MIRT585763 Sri sorcin 1 1
MIRT586098 Reep5 receptor accessory protein 5 1 1
MIRT586122 Rccd1 RCC1 domain containing 1 1 1
MIRT587443 Dimt1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT587532 Cxxc5 CXXC finger 5 1 1
MIRT588361 Zfp518b zinc finger protein 518B 1 1
MIRT588471 Wwtr1 WW domain containing transcription regulator 1 1 1
MIRT588621 Trak2 trafficking protein, kinesin binding 2 1 1
MIRT588694 Tet2 tet methylcytosine dioxygenase 2 1 1
MIRT588845 Sort1 sortilin 1 1 1
MIRT588975 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT589265 Plau plasminogen activator, urokinase 1 1
MIRT589380 Ntrk3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT589448 Nck2 non-catalytic region of tyrosine kinase adaptor protein 2 1 1
MIRT589537 Mllt3 myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 1 1
MIRT590501 Cacnb2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT590675 Anln anillin, actin binding protein 1 3
MIRT590760 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT590793 4921524J17Rik RIKEN cDNA 4921524J17 gene 1 1
MIRT593049 Nf2 neurofibromin 2 1 1
MIRT594247 Sox11 SRY (sex determining region Y)-box 11 1 1
MIRT594397 Ints6 integrator complex subunit 6 1 1
MIRT594713 Zwint ZW10 interactor 1 1
MIRT594773 Tex12 testis expressed gene 12 1 1
MIRT594789 Slitrk2 SLIT and NTRK-like family, member 2 1 1
MIRT595121 Mex3b mex3 RNA binding family member B 1 1
MIRT595540 Etv3 ets variant 3 1 1
MIRT595680 Rnf6 ring finger protein (C3H2C3 type) 6 1 1
MIRT595834 Tmem56 transmembrane protein 56 1 1
MIRT595895 Cd69 CD69 antigen 1 1
MIRT595961 Znrf1 zinc and ring finger 1 1 1
MIRT595980 Ocrl OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT596011 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596189 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT603672 Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1

Error report submission