| pre-miRNA Information | |
|---|---|
| pre-miRNA | mmu-mir-208a |
| Genomic Coordinates | chr14: 54949060 - 54949142 |
| Description | Mus musculus miR-208a stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | mmu-miR-208a-5p |
| Sequence | 15| GAGCUUUUGGCCCGGGUUAUAC |36 |
| Evidence | Experimental |
| Experiments | Illumina |
| Putative Targets | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | Opn5 | ||||||||||||||||||||
| Synonyms | Gpr136, Neuropsin, PGR12, TMEM13 | ||||||||||||||||||||
| Description | opsin 5 | ||||||||||||||||||||
| Transcript | NM_181753 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on Opn5 | |||||||||||||||||||||
| 3'UTR of Opn5 (miRNA target sites are highlighted) |
>Opn5|NM_181753|3'UTR 1 GCACCTGTGTTCTGAGGCCGAGAAACCCCGCACCTGTCCATCAGGGCTTCAGAAATAAGTGGCCAGCTTCAATATACTCT 81 TTGAAATGCTGAAAAAAAAAAGCTGTAGTGTATTCTTTGCATTTGTTTTTAAGTTTGAGAAAACATATGGTCAGCGTTGA 161 CTGCAGTGTTGATATTGAAGTTTAATCATGAATACATAGCATGTGAAGTGTCCACTCTTTAGGCTTTATAAGACGATTAA 241 AGTGTTCTAAGGAGAAAGCACATCCTAAGCTTGGGAAGTGCATCACCCCTTAAGCTTCCTATTCATCGTGATAGTAATGG 321 AGCTTATCGATGCATTCATGACTGTGAACATGCCTTTGAAACTGTCAACCACTTCTTGTACACGGTTAGAATTTTGAACA 401 TTTATCTGGGAAGCTTCTAACAGCATACTCTGTCAAGTCAACTTGTACATAGTATTTGTAAGTACTCTCTATGAGAACAT 481 TCAGAAGATGTTTTAGTGTTTGACTCATTCACTTTGTCCCAGTTGTGTGTCGAACTGAAGAACAGTTTGTTGACTGTACT 561 AGGAAAGAATGCATTAGTACTTTTCATCTCTGTCCATCTCTCTTTGCACACTGAAATAGTTTTCTTTTGAAGCCATAGCT 641 GCTGTTCAAGTCCTTTTTTTTTTAAATAAAGAAAATATATTGCACC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | CD4+ T cells (C57BL/6) | ||||||
| Disease | MIMAT0017014 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013581. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
||||||
| CLIP-seq Support 1 for dataset GSM1013581 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | CD4+ T cells (C57BL/6) / CD4+ T cells, 155KO, biological rep7 |
| Location of target site | NM_181753 | 3UTR | AAAUGCUGAAAAAAAAAAGCUGUAGUGUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23142080 / GSE41285 |
| CLIP-seq Viewer | Link |
30 mmu-miR-208a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT577883 | Qpct | glutaminyl-peptide cyclotransferase (glutaminyl cyclase) |  |
|
2 | 2 | ||||||
| MIRT579319 | B3galnt1 | UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 | |
|
2 | 2 | ||||||
| MIRT579650 | 2510002D24Rik | RIKEN cDNA 2510002D24 gene | |
|
2 | 2 | ||||||
| MIRT579796 | Zfp300 | zinc finger protein 300 | |
|
2 | 2 | ||||||
| MIRT580636 | Suz12 | suppressor of zeste 12 homolog (Drosophila) | |
|
2 | 4 | ||||||
| MIRT581361 | Reep3 | receptor accessory protein 3 | |
|
2 | 6 | ||||||
| MIRT581857 | Pik3r1 | phosphoinositide-3-kinase regulatory subunit 1 | |
|
2 | 2 | ||||||
| MIRT583433 | Frmd6 | FERM domain containing 6 | |
|
2 | 4 | ||||||
| MIRT584342 | Cdyl2 | chromodomain protein, Y chromosome-like 2 | |
|
2 | 2 | ||||||
| MIRT586902 | Hist2h2be | histone cluster 2, H2be | |
|
2 | 2 | ||||||
| MIRT589714 | Kitl | kit ligand | |
|
2 | 2 | ||||||
| MIRT591273 | Lars2 | leucyl-tRNA synthetase, mitochondrial | |
|
2 | 4 | ||||||
| MIRT593811 | Lztfl1 | leucine zipper transcription factor-like 1 | |
|
2 | 2 | ||||||
| MIRT593895 | Edaradd | EDAR (ectodysplasin-A receptor)-associated death domain | |
|
2 | 2 | ||||||
| MIRT594222 | Trim8 | tripartite motif-containing 8 | |
|
2 | 2 | ||||||
| MIRT594501 | Clmn | calmin | |
|
2 | 2 | ||||||
| MIRT594507 | Cd99l2 | CD99 antigen-like 2 | |
|
2 | 2 | ||||||
| MIRT594522 | Bicd2 | bicaudal D homolog 2 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT594566 | 4930563D23Rik | RIKEN cDNA 4930563D23 gene | |
|
2 | 2 | ||||||
| MIRT594769 | Tmem132c | transmembrane protein 132C | |
|
2 | 2 | ||||||
| MIRT594821 | Pknox1 | Pbx/knotted 1 homeobox | |
|
2 | 2 | ||||||
| MIRT594967 | Tmem255a | transmembrane protein 255A | |
1 | 1 | |||||||
| MIRT595117 | Prtg | protogenin | |
|
2 | 2 | ||||||
| MIRT595124 | Maml3 | mastermind like 3 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT595307 | Gpr35 | G protein-coupled receptor 35 | |
|
2 | 2 | ||||||
| MIRT595351 | Fgfr1op2 | FGFR1 oncogene partner 2 | |
|
2 | 2 | ||||||
| MIRT595874 | Csmd1 | CUB and Sushi multiple domains 1 | |
|
2 | 2 | ||||||
| MIRT596155 | Opn5 | opsin 5 | |
|
2 | 2 | ||||||
| MIRT604065 | Eno2 | enolase 2, gamma neuronal | |
|
2 | 2 | ||||||
| MIRT604938 | Gprc5b | G protein-coupled receptor, family C, group 5, member B | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|