miRTarBase - #MIRT596829


—
pre-miRNA Information
pre-miRNA mmu-mir-546   
Genomic Coordinates chr10: 126998440 - 126998560
Synonyms Mirn546, mmu-mir-546, Mir546
Description Mus musculus miR-546 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-546
Sequence 32| AUGGUGGCACGGAGUC |47
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Ttll1   
Synonyms 6330444E16Rik, AV014541
Description tubulin tyrosine ligase-like 1
Transcript NM_178869   
Expression
Putative miRNA Targets on Ttll1
3'UTR of Ttll1
(miRNA target sites are highlighted)		 
>Ttll1|NM_178869|3'UTR
   1 CCAGCAGCGAGAAGAAGGACCCCAGCTTGGACCTTCCCACAGTCGCTCCACCCAGTCCCTGCTAAACACCCGTTTTGGAA
  81 TTTCAGTTTTCCAGAGTGCTTTCCTGAGCAGGCCTTGTAAATAAAGACTCAATGCAAGGTGGAGGAGTCCACATCACTGG
 161 GGCTCAAGCACTTGCAAGTGCACACATGCACACACACACACACACACGCACGCACGCACGCACGCACACATGCACACACA
 241 AAAACAACAGCTTCGGTATGTGATGGAACTTCCTTTTTTAAAGATTTATTATTTTTGAGATAGGTACCTCTGGATGGCCT
 321 GGAACTTGCCATGTAGACCAGGCTGGCCTAGAACTCACAGAGATCTACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAG
 401 GTGTGTGCCACCACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cugAGGCACGGUGGUa 5'
             | :||||||||| 
Target 5' aggTGTGTGCCACCAc 3'
 399 - 414 153.00 -17.40
2 
miRNA  3' cugaggcacGGUGGua 5'
                   |||||  
Target 5' acagtcgctCCACCca 3'
 39 - 54 100.00 -9.60
3 
miRNA  3' cuGAGGCACGGUGGua 5'
            |||  |||| ||  
Target 5' gcCTC--TGCCTCCca 3'
 371 - 384 98.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1 HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
CLIP-seq Support 1 for dataset GSM622570
Method / RBP HITS-CLIP / AGO2
Cell line / Condition mESCs / WT1A
Location of target site NM_178869 | 3UTR | AAGUGCUGGGAUUAAAGGUGUGUGCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21258322 / GSE25310
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM622571
Method / RBP HITS-CLIP / AGO2
Cell line / Condition mESCs / WT1B
Location of target site NM_178869 | 3UTR | AAGUGCUGGGAUUAAAGGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21258322 / GSE25310
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM622573
Method / RBP HITS-CLIP / AGO2
Cell line / Condition mESCs / KO1
Location of target site NM_178869 | 3UTR | AGAGAUCUACCUGCCUCUGCCUCCCAAGUGCUGGGAUUAAAGGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21258322 / GSE25310
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM622574
Method / RBP HITS-CLIP / AGO2
Cell line / Condition mESCs / KO2
Location of target site NM_178869 | 3UTR | AAGUGCUGGGAUUAAAGGUGUGUGCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21258322 / GSE25310
CLIP-seq Viewer Link
142 mmu-miR-546 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT425281 Snhg11 small nucleolar RNA host gene 11 2 2
MIRT577800 Rnmtl1 mitochondrial rRNA methyltransferase 3 2 2
MIRT578752 Gm2a GM2 ganglioside activator protein 2 2
MIRT585410 Wdr85 diphthamine biosynethesis 7 2 4
MIRT585537 Trim27 tripartite motif-containing 27 2 4
MIRT585576 Tpmt thiopurine methyltransferase 2 4
MIRT585648 Tmco3 transmembrane and coiled-coil domains 3 2 2
MIRT585854 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 4
MIRT586844 Ikbkg inhibitor of kappaB kinase gamma 2 4
MIRT586931 H2-T24 histocompatibility 2, T region locus 24 2 4
MIRT587006 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 4
MIRT587401 Dnase2a deoxyribonuclease II alpha 2 2
MIRT588270 Smco1 single-pass membrane protein with coiled-coil domains 1 1 1
MIRT589551 Mga MAX gene associated 2 4
MIRT590030 Fbxo43 F-box protein 43 2 2
MIRT590120 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 2 4
MIRT591419 Cd300a CD300A molecule 2 4
MIRT593669 Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 2 2
MIRT593716 Pum2 pumilio RNA-binding family member 2 2 2
MIRT593818 Lpl lipoprotein lipase 2 2
MIRT594425 Gdf3 growth differentiation factor 3 2 4
MIRT595457 Ptrhd1 peptidyl-tRNA hydrolase domain containing 1 1 1
MIRT596195 Fyco1 FYVE and coiled-coil domain containing 1 2 2
MIRT596502 Zfp933 zinc finger protein 933 2 2
MIRT596563 Zfp799 zinc finger protein 799 2 2
MIRT596683 Zc3hav1l zinc finger CCCH-type, antiviral 1-like 2 2
MIRT596829 Ttll1 tubulin tyrosine ligase-like 1 2 2
MIRT596860 Ttc26 tetratricopeptide repeat domain 26 2 2
MIRT596941 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT596960 Tmem88b transmembrane protein 88B 2 2
MIRT597020 Thap2 THAP domain containing, apoptosis associated protein 2 2 2
MIRT597136 Sumf2 sulfatase modifying factor 2 2 2
MIRT597317 Sgol2 shugoshin 2A 2 2
MIRT597336 Sema4b sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 2 2
MIRT597342 Sec23ip Sec23 interacting protein 2 2
MIRT597418 Rpl7l1 ribosomal protein L7-like 1 2 2
MIRT597468 Trmt10a tRNA methyltransferase 10A 1 1
MIRT597714 Pphln1 periphilin 1 2 2
MIRT597803 Pla2r1 phospholipase A2 receptor 1 2 2
MIRT597858 Pfkl phosphofructokinase, liver, B-type 2 2
MIRT597896 Paxip1 PAX interacting (with transcription-activation domain) protein 1 2 2
MIRT598034 Noc3l NOC3 like DNA replication regulator 2 2
MIRT598039 Nkiras1 NFKB inhibitor interacting Ras-like protein 1 2 2
MIRT598078 Neu3 neuraminidase 3 2 2
MIRT598116 Ncan neurocan 2 2
MIRT598283 Mdc1 mediator of DNA damage checkpoint 1 2 2
MIRT598324 Mbd4 methyl-CpG binding domain protein 4 2 2
MIRT598408 Ly6g6d lymphocyte antigen 6 complex, locus G6D 2 2
MIRT598460 Krt222 keratin 222 2 2
MIRT598470 Klhdc9 kelch domain containing 9 2 2
MIRT598474 Kif15 kinesin family member 15 2 2
MIRT598527 Itsn1 intersectin 1 (SH3 domain protein 1A) 2 2
MIRT598712 H2afv H2A histone family, member V 2 2
MIRT598805 Gm5113 predicted gene 5113 2 2
MIRT598950 Ggps1 geranylgeranyl diphosphate synthase 1 2 2
MIRT599059 Epb4.2 erythrocyte membrane protein band 4.2 2 2
MIRT599132 Dqx1 DEAQ RNA-dependent ATPase 2 2
MIRT599204 Ddhd2 DDHD domain containing 2 2 2
MIRT599269 D14Abb1e family with sequence similarity 208, member A 2 2
MIRT599281 Cyld CYLD lysine 63 deubiquitinase 2 2
MIRT599345 Commd7 COMM domain containing 7 2 2
MIRT599454 Cdnf cerebral dopamine neurotrophic factor 2 2
MIRT599599 Bloc1s3 biogenesis of lysosomal organelles complex-1, subunit 3 2 2
MIRT599612 Birc5 baculoviral IAP repeat-containing 5 2 2
MIRT599652 B4galnt2 beta-1,4-N-acetyl-galactosaminyl transferase 2 2 2
MIRT599710 Apod apolipoprotein D 2 2
MIRT599856 Actr10 ARP10 actin-related protein 10 2 2
MIRT599933 Rmi2 RecQ mediated genome instability 2 1 1
MIRT600084 2010315B03Rik RIKEN cDNA 2010315B03 gene 2 2
MIRT600161 Zbtb44 zinc finger and BTB domain containing 44 2 2
MIRT600240 Trim36 tripartite motif-containing 36 2 2
MIRT600284 Tmem69 transmembrane protein 69 2 2
MIRT600548 Padi2 peptidyl arginine deiminase, type II 2 2
MIRT600665 March5 membrane-associated ring finger (C3HC4) 5 2 2
MIRT600678 Mapre1 microtubule-associated protein, RP/EB family, member 1 2 2
MIRT600855 Gas2l3 growth arrest-specific 2 like 3 2 2
MIRT600920 Exoc8 exocyst complex component 8 2 2
MIRT600932 Elovl7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 2 2
MIRT601045 Cnih4 cornichon family AMPA receptor auxiliary protein 4 2 2
MIRT601079 Ccdc85b coiled-coil domain containing 85B 2 2
MIRT601085 Cbln3 cerebellin 3 precursor protein 2 2
MIRT601269 Soga1 suppressor of glucose, autophagy associated 1 1 1
MIRT601283 Saysd1 SAYSVFN motif domain containing 1 1 1
MIRT601312 Zfp830 zinc finger protein 830 2 2
MIRT601419 Tyr tyrosinase 2 2
MIRT601456 Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 2 2
MIRT601640 Slc12a8 solute carrier family 12 (potassium/chloride transporters), member 8 2 2
MIRT601654 Sfxn2 sideroflexin 2 2 2
MIRT601763 Ranbp3l RAN binding protein 3-like 2 2
MIRT601846 Polr1b polymerase (RNA) I polypeptide B 2 2
MIRT601982 Nanog Nanog homeobox 2 2
MIRT602082 Lrp4 low density lipoprotein receptor-related protein 4 2 2
MIRT602092 Ldlrad2 low density lipoprotein receptor A domain containing 2 2 2
MIRT602145 Ajuba ajuba LIM protein 1 1
MIRT602297 Gla galactosidase, alpha 2 2
MIRT602341 Fundc2 FUN14 domain containing 2 2 2
MIRT602343 Fnip2 folliculin interacting protein 2 2 2
MIRT602500 Dffb DNA fragmentation factor, beta subunit 2 2
MIRT602600 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT602625 Cenpl centromere protein L 2 2
MIRT602643 Cd93 CD93 antigen 2 2
MIRT602957 Xpo7 exportin 7 2 2
MIRT603093 Zfp287 zinc finger protein 287 2 2
MIRT603325 Slc35d2 solute carrier family 35, member D2 2 2
MIRT603487 Rbm11 RNA binding motif protein 11 2 2
MIRT603511 Rab11b RAB11B, member RAS oncogene family 2 2
MIRT603603 Pigv phosphatidylinositol glycan anchor biosynthesis, class V 2 2
MIRT603985 Gm7616 predicted gene 7616 2 2
MIRT604003 Gje1 gap junction protein, epsilon 1 2 2
MIRT604009 Ggcx gamma-glutamyl carboxylase 2 2
MIRT604106 Dis3l DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT604126 Ddx58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 2 2
MIRT604162 Cyb5d2 cytochrome b5 domain containing 2 2 2
MIRT604521 1200011I18Rik GPALPP motifs containing 1 2 2
MIRT604574 Ttyh1 tweety family member 1 2 2
MIRT604611 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 2 2
MIRT604687 Sgk3 serum/glucocorticoid regulated kinase 3 2 2
MIRT604843 Mrpl35 mitochondrial ribosomal protein L35 2 2
MIRT604895 Kdelc2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 2
MIRT605026 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 2 2
MIRT605125 Cnnm3 cyclin M3 2 2
MIRT605148 Ccdc55 nuclear speckle regulatory protein 1 2 2
MIRT605382 Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 2 2
MIRT605728 Gm5531 transmembrane epididymal protein 1B 2 2
MIRT605749 Fam161b family with sequence similarity 161, member B 2 2
MIRT605782 Depdc5 DEP domain containing 5 2 2
MIRT605908 Zmat3 zinc finger matrin type 3 2 2
MIRT605997 Homez homeodomain leucine zipper-encoding gene 2 2
MIRT606072 Zfp282 zinc finger protein 282 2 2
MIRT606110 Ubxn8 UBX domain protein 8 2 2
MIRT606199 Sfxn4 sideroflexin 4 2 2
MIRT606222 Rhoh ras homolog family member H 2 2
MIRT606267 Pfas phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) 2 2
MIRT606284 Nufip1 nuclear fragile X mental retardation protein interacting protein 1 2 2
MIRT606325 Mrps24 mitochondrial ribosomal protein S24 2 2
MIRT606341 Lrrc39 leucine rich repeat containing 39 2 2
MIRT606443 Fam118a family with sequence similarity 118, member A 2 2
MIRT606461 Ecm2 extracellular matrix protein 2, female organ and adipocyte specific 2 2
MIRT606481 Ctsa cathepsin A 2 2
MIRT606485 Ctcfl CCCTC-binding factor (zinc finger protein)-like 2 2
MIRT606512 Bpnt1 bisphosphate 3'-nucleotidase 1 2 2
MIRT606599 Tmem206 transmembrane protein 206 2 2

Error report submission