pre-miRNA Information
pre-miRNA mmu-mir-677   
Genomic Coordinates chr10: 128085286 - 128085363
Synonyms Mirn677, mmu-mir-677, Mir677
Description Mus musculus miR-677 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-677-5p
Sequence 6| UUCAGUGAUGAUUAGCUUCUGA |27
Evidence Experimental
Experiments MPSS
Putative Targets

Gene Information
Gene Symbol Slc25a33   
Synonyms 5730438N18Rik, Pnc1
Description solute carrier family 25, member 33
Transcript NM_027460   
Expression
Putative miRNA Targets on Slc25a33
3'UTR of Slc25a33
(miRNA target sites are highlighted)
>Slc25a33|NM_027460|3'UTR
   1 TGACAGGGCCACATGGTTGTGCTCTAGAAGAATAAAACTGAAAACCCTAGAGATTTTCTTTTCCGTTGATGTTTAGTGTT
  81 CAAAACTGAAACAGCGAAGGCCATAGAATACCTGGCTCATGTCACCTGTTGGACATTTCCTTTTGGATTCTTGTTTCTGG
 161 AAGGTTGAAATTCATTAACGTTAATAGTTAATTATAACTTTCTTTTTTAACTTAAGAGGACTGAGGATTGAGGAGCAAGT
 241 AAATTAAATCATGCTATTTAATGTAAGTTCGTGCTGGGCTGTGTTCTCCTTTGTGCTTACTGGGCTGCCCTAAGCCGGCC
 321 ACGGGGTCTGGCTGGGCGTGGGGAAGTGAGAAGCGTGACTTGTGGGGACTGAGTGGTGGACAGGAAAGAGCGGTCACGCT
 401 TGGTGACAACTGTGAGCAAATGGTCCACAGCTTTCCCTCTGTACATCTCCATCTCCCCCCTCCATGGTGGTAGGTTTATC
 481 TGTAATCTGTTTCCAGACACTGAATGGGGGTGGGGGTGGGGGTGGAGTGTAACTTCCTTAACCACCCCACCCCCCACCCT
 561 TTCTGAGTCAGGGTCTTGGTGCTGTAGCCCAGACTGATCTTCACCTTTAAATCTCCTGCCTCAGCCTCCCAAGGGCTGAA
 641 AATGCAGATGTACACCCTGGGCCTGACCTAGCTGGACAATAAAAACTGCTTTTAGCTACATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agucuucgauuaguaGUGACUu 5'
                         |||||| 
Target 5' taatctgtttccagaCACTGAa 3'
483 - 504 120.00 -9.60
2
miRNA  3' agucuucGAUUAGUAGUGACUu 5'
                 :| :|  |:||||: 
Target 5' gttctccTTTGTGCTTACTGGg 3'
283 - 304 111.00 -6.20
3
miRNA  3' agUCUUCGAUUAGUAGUGacuu 5'
            |||  ||:||| ||||    
Target 5' ccAGA--CTGATCTTCACcttt 3'
589 - 608 108.00 -12.06
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
44 mmu-miR-677-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT580133 Ubap2l ubiquitin-associated protein 2-like 1 1
MIRT582833 Itgb3 integrin beta 3 1 4
MIRT583171 Grik3 glutamate receptor, ionotropic, kainate 3 1 3
MIRT583782 Elovl7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 1 2
MIRT585951 Sin3a transcriptional regulator, SIN3A (yeast) 1 1
MIRT589768 Iws1 IWS1, SUPT6 interacting protein 1 1
MIRT591164 Mup19 major urinary protein 19 1 1
MIRT591170 Mup12 major urinary protein 12 1 1
MIRT591176 Mup10 major urinary protein 10 1 1
MIRT591807 Mup14 major urinary protein 14 1 1
MIRT592567 Mup17 major urinary protein 17 1 1
MIRT592608 Mup11 major urinary protein 11 1 1
MIRT593180 Clasp1 CLIP associating protein 1 1 1
MIRT594028 5430427O19Rik RIKEN cDNA 5430427O19 gene 1 1
MIRT595083 Zfp516 zinc finger protein 516 1 1
MIRT595535 Fign fidgetin 1 1
MIRT595555 Ubr3 ubiquitin protein ligase E3 component n-recognin 3 1 1
MIRT595557 Tcte1 t-complex-associated testis expressed 1 1 1
MIRT595562 Sptbn1 spectrin beta, non-erythrocytic 1 1 1
MIRT595569 Nrsn1 neurensin 1 1 1
MIRT595571 Mtf1 metal response element binding transcription factor 1 1 1
MIRT595579 Josd1 Josephin domain containing 1 1 1
MIRT595580 Fam101b refilin B 1 1
MIRT595587 4930444A02Rik protein-O-mannose kinase 1 1
MIRT595593 Ago1 argonaute RISC catalytic subunit 1 1 1
MIRT595602 Nbl1 neuroblastoma, suppression of tumorigenicity 1 1 1
MIRT595604 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT595625 Nol7 nucleolar protein 7 1 1
MIRT595629 Gnptg N-acetylglucosamine-1-phosphotransferase, gamma subunit 1 1
MIRT595633 Ednra endothelin receptor type A 1 1
MIRT595649 B3galt5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 1
MIRT595667 Rxrb retinoid X receptor beta 1 1
MIRT595743 Ctdspl2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT595789 Fignl2 fidgetin-like 2 1 1
MIRT595880 Gid4 GID complex subunit 4, VID24 homolog 1 1
MIRT595909 Tapt1 transmembrane anterior posterior transformation 1 1 1
MIRT595919 Trim9 tripartite motif-containing 9 1 1
MIRT595925 Efr3a EFR3 homolog A 1 1
MIRT595937 Acmsd amino carboxymuconate semialdehyde decarboxylase 1 1
MIRT595943 B3gnt5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT596004 Disp2 dispatched RND tramsporter family member 2 1 1
MIRT596008 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596167 Ms4a15 membrane-spanning 4-domains, subfamily A, member 15 1 1
MIRT597273 Slc25a33 solute carrier family 25, member 33 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-677 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated

Error report submission