miRNA Infomation | |
---|---|
miRNA name | mmu-miR-1186a |
Gene Information | |
---|---|
Gene Symbol | Med16 |
Synonyms | 95kDa, A630083L04, Thrap5, Trap95 |
Description | mediator complex subunit 16 |
Transcript | NM_001163276 |
Other Transcripts | NM_198107 |
Expression | |
Putative miRNA Targets on Med16 | |
3'UTR of Med16 (miRNA target sites are highlighted) |
>Med16|NM_001163276|3'UTR 1 GCCACAGCCCACCAGCCTGCGTATGTACAACCAGTCTCTGAACATTGACATTGCTGTGCTCACTGAGGCACAAGTACCCA 81 CCAATGGCCCCTGGGTCTGCCCCTTCTAGGGACATGCGGCATCTCTAGGGCCTGAAGTCCCATGGTCATATCCAAGCCAG 161 TGTGAAGGAGCTGGGCTGTGTATTCATCCTTTAAAAGATCCACAGTGGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAG 241 CACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGC 321 TACACAGAGAAACCCTGTCTCGAAAAAACAAAACAAAAAAAAAAAAAGATTCACAGTACATAAAGCCCCTTGTCCTGCTT 401 GGGGTCGTCTGCCTCAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCTCAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCT 481 CAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCTCAGTTTTCTTTGGGTGCCGGTGGGAGGGGAAGACTGGCCCAATAAAG 561 TTCTCTGATGCACTAGG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
114 mmu-miR-1186a Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT579774 | Zfp568 | zinc finger protein 568 | ![]() |
1 | 1 | |||||||
MIRT580629 | Sycp2 | synaptonemal complex protein 2 | ![]() |
1 | 1 | |||||||
MIRT582212 | Nfatc3 | nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 | ![]() |
1 | 1 | |||||||
MIRT582800 | Kcnmb2 | potassium large conductance calcium-activated channel, subfamily M, beta member 2 | ![]() |
1 | 1 | |||||||
MIRT585391 | Wfs1 | wolframin ER transmembrane glycoprotein | ![]() |
1 | 2 | |||||||
MIRT589502 | Myo1e | myosin IE | ![]() |
1 | 2 | |||||||
MIRT589770 | Itgb3 | integrin beta 3 | ![]() |
1 | 1 | |||||||
MIRT593622 | Tstd2 | thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT593854 | Havcr2 | hepatitis A virus cellular receptor 2 | ![]() |
1 | 1 | |||||||
MIRT594849 | Npm3 | nucleoplasmin 3 | ![]() |
1 | 1 | |||||||
MIRT596507 | Zfp933 | zinc finger protein 933 | ![]() |
1 | 1 | |||||||
MIRT596526 | Zfp882 | zinc finger protein 882 | ![]() |
1 | 1 | |||||||
MIRT596548 | Zfp866 | zinc finger protein 866 | ![]() |
1 | 1 | |||||||
MIRT596772 | Usp45 | ubiquitin specific petidase 45 | ![]() |
1 | 1 | |||||||
MIRT596785 | Ubxn2a | UBX domain protein 2A | ![]() |
1 | 1 | |||||||
MIRT596892 | Trp53rk | transformation related protein 53 regulating kinase B | ![]() |
1 | 1 | |||||||
MIRT596930 | Tprkb | Tp53rk binding protein | ![]() |
1 | 1 | |||||||
MIRT596959 | Tmem88b | transmembrane protein 88B | ![]() |
1 | 1 | |||||||
MIRT597152 | Stxbp4 | syntaxin binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT597426 | Rp2h | retinitis pigmentosa 2 homolog | ![]() |
1 | 1 | |||||||
MIRT597534 | Rapgef4 | Rap guanine nucleotide exchange factor (GEF) 4 | ![]() |
1 | 1 | |||||||
MIRT597584 | Ptpn7 | protein tyrosine phosphatase, non-receptor type 7 | ![]() |
1 | 1 | |||||||
MIRT597695 | Ppp2r3d | protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta | ![]() |
1 | 1 | |||||||
MIRT598007 | Npy1r | neuropeptide Y receptor Y1 | ![]() |
1 | 1 | |||||||
MIRT598031 | Nol10 | nucleolar protein 10 | ![]() |
1 | 1 | |||||||
MIRT598115 | Ncl | nucleolin | ![]() |
1 | 1 | |||||||
MIRT598155 | Mtif2 | mitochondrial translational initiation factor 2 | ![]() |
1 | 1 | |||||||
MIRT598268 | Mettl2 | methyltransferase like 2 | ![]() |
1 | 1 | |||||||
MIRT598274 | Med16 | mediator complex subunit 16 | ![]() |
1 | 1 | |||||||
MIRT598308 | Mc1r | melanocortin 1 receptor | ![]() |
1 | 1 | |||||||
MIRT598344 | Mau2 | MAU2 sister chromatid cohesion factor | ![]() |
1 | 1 | |||||||
MIRT598391 | Magt1 | magnesium transporter 1 | ![]() |
1 | 1 | |||||||
MIRT598427 | Lrrc14b | leucine rich repeat containing 14B | ![]() |
1 | 1 | |||||||
MIRT598438 | Lpl | lipoprotein lipase | ![]() |
1 | 1 | |||||||
MIRT598663 | Hpgds | hematopoietic prostaglandin D synthase | ![]() |
1 | 1 | |||||||
MIRT598704 | Haus2 | HAUS augmin-like complex, subunit 2 | ![]() |
1 | 1 | |||||||
MIRT598875 | Glyctk | glycerate kinase | ![]() |
1 | 1 | |||||||
MIRT598888 | Glrx2 | glutaredoxin 2 (thioltransferase) | ![]() |
1 | 1 | |||||||
MIRT598958 | Gemin8 | gem nuclear organelle associated protein 8 | ![]() |
1 | 1 | |||||||
MIRT599163 | Diap2 | diaphanous related formin 2 | ![]() |
1 | 1 | |||||||
MIRT599256 | Tmem245 | transmembrane protein 245 | ![]() |
1 | 1 | |||||||
MIRT599387 | Clmn | calmin | ![]() |
1 | 1 | |||||||
MIRT599416 | Chek2 | checkpoint kinase 2 | ![]() |
1 | 1 | |||||||
MIRT599521 | Cbwd1 | COBW domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT599544 | Car5b | carbonic anhydrase 5b, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT599748 | Anapc16 | anaphase promoting complex subunit 16 | ![]() |
1 | 1 | |||||||
MIRT599851 | Adarb1 | adenosine deaminase, RNA-specific, B1 | ![]() |
1 | 1 | |||||||
MIRT599902 | Acat1 | acetyl-Coenzyme A acetyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT599921 | A830018L16Rik | RIKEN cDNA A830018L16 gene | ![]() |
1 | 1 | |||||||
MIRT599997 | 4930579G24Rik | RIKEN cDNA 4930579G24 gene | ![]() |
1 | 1 | |||||||
MIRT600230 | Trim56 | tripartite motif-containing 56 | ![]() |
1 | 1 | |||||||
MIRT600272 | Tns4 | tensin 4 | ![]() |
1 | 1 | |||||||
MIRT600359 | Srrm4 | serine/arginine repetitive matrix 4 | ![]() |
1 | 1 | |||||||
MIRT600536 | Pdzd2 | PDZ domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT600568 | Ociad2 | OCIA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT600688 | Lrrc8e | leucine rich repeat containing 8 family, member E | ![]() |
1 | 1 | |||||||
MIRT600869 | Gad2 | glutamic acid decarboxylase 2 | ![]() |
1 | 1 | |||||||
MIRT600880 | Gabpb2 | GA repeat binding protein, beta 2 | ![]() |
1 | 1 | |||||||
MIRT600957 | Elf1 | E74-like factor 1 | ![]() |
1 | 1 | |||||||
MIRT601037 | Cntn2 | contactin 2 | ![]() |
1 | 1 | |||||||
MIRT601117 | Bri3bp | Bri3 binding protein | ![]() |
1 | 1 | |||||||
MIRT601253 | Abl2 | v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) | ![]() |
1 | 1 | |||||||
MIRT601372 | Ybey | ybeY metallopeptidase | ![]() |
1 | 1 | |||||||
MIRT601482 | Tmod1 | tropomodulin 1 | ![]() |
1 | 1 | |||||||
MIRT601550 | Tbc1d24 | TBC1 domain family, member 24 | ![]() |
1 | 1 | |||||||
MIRT601675 | Sco1 | SCO1 cytochrome c oxidase assembly protein | ![]() |
1 | 1 | |||||||
MIRT601939 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | ![]() |
1 | 1 | |||||||
MIRT601945 | Nwd1 | NACHT and WD repeat domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT601976 | Nav1 | neuron navigator 1 | ![]() |
1 | 1 | |||||||
MIRT602013 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | ![]() |
1 | 1 | |||||||
MIRT602121 | Kremen2 | kringle containing transmembrane protein 2 | ![]() |
1 | 1 | |||||||
MIRT602189 | Hyal1 | hyaluronoglucosaminidase 1 | ![]() |
1 | 1 | |||||||
MIRT602215 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT602246 | Grm1 | glutamate receptor, metabotropic 1 | ![]() |
1 | 1 | |||||||
MIRT602369 | Fbxl3 | F-box and leucine-rich repeat protein 3 | ![]() |
1 | 1 | |||||||
MIRT602428 | Ercc4 | excision repair cross-complementing rodent repair deficiency, complementation group 4 | ![]() |
1 | 1 | |||||||
MIRT602494 | Dkc1 | dyskeratosis congenita 1, dyskerin | ![]() |
1 | 1 | |||||||
MIRT602567 | Csf2rb | colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) | ![]() |
1 | 1 | |||||||
MIRT602597 | Chrnb4 | cholinergic receptor, nicotinic, beta polypeptide 4 | ![]() |
1 | 1 | |||||||
MIRT602687 | Camk4 | calcium/calmodulin-dependent protein kinase IV | ![]() |
1 | 1 | |||||||
MIRT602764 | Asxl2 | additional sex combs like 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT602851 | Abcd2 | ATP-binding cassette, sub-family D (ALD), member 2 | ![]() |
1 | 1 | |||||||
MIRT602908 | 2210016F16Rik | RIKEN cDNA 2210016F16 gene | ![]() |
1 | 1 | |||||||
MIRT603036 | Chic1 | cysteine-rich hydrophobic domain 1 | ![]() |
1 | 1 | |||||||
MIRT603112 | Xcr1 | chemokine (C motif) receptor 1 | ![]() |
1 | 1 | |||||||
MIRT603146 | Ubxn8 | UBX domain protein 8 | ![]() |
1 | 1 | |||||||
MIRT603156 | Ubxn4 | UBX domain protein 4 | ![]() |
1 | 1 | |||||||
MIRT603435 | Rpl7l1 | ribosomal protein L7-like 1 | ![]() |
1 | 1 | |||||||
MIRT603455 | Rhbdl2 | rhomboid, veinlet-like 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT603518 | Pxmp4 | peroxisomal membrane protein 4 | ![]() |
1 | 1 | |||||||
MIRT603818 | Kif5b | kinesin family member 5B | ![]() |
1 | 1 | |||||||
MIRT603872 | Il11 | interleukin 11 | ![]() |
1 | 1 | |||||||
MIRT603888 | Il10rb | interleukin 10 receptor, beta | ![]() |
1 | 1 | |||||||
MIRT603916 | Hltf | helicase-like transcription factor | ![]() |
1 | 1 | |||||||
MIRT603974 | Gnal | guanine nucleotide binding protein, alpha stimulating, olfactory type | ![]() |
1 | 1 | |||||||
MIRT604054 | Erich1 | glutamate rich 1 | ![]() |
1 | 1 | |||||||
MIRT604186 | Cxcl11 | chemokine (C-X-C motif) ligand 11 | ![]() |
1 | 1 | |||||||
MIRT604293 | Ccdc36 | coiled-coil domain containing 36 | ![]() |
1 | 1 | |||||||
MIRT604399 | Aida | axin interactor, dorsalization associated | ![]() |
1 | 1 | |||||||
MIRT604524 | Ccdc167 | coiled-coil domain containing 167 | ![]() |
1 | 1 | |||||||
MIRT604531 | Zmym5 | zinc finger, MYM-type 5 | ![]() |
1 | 1 | |||||||
MIRT604577 | Trip4 | thyroid hormone receptor interactor 4 | ![]() |
1 | 1 | |||||||
MIRT604627 | Syt11 | synaptotagmin XI | ![]() |
1 | 1 | |||||||
MIRT604718 | Samd8 | sterile alpha motif domain containing 8 | ![]() |
1 | 1 | |||||||
MIRT604761 | Rab27a | RAB27A, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT604851 | Mprip | myosin phosphatase Rho interacting protein | ![]() |
1 | 1 | |||||||
MIRT604966 | Gga2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT605164 | C030039L03Rik | zinc finger protein 607B | ![]() |
1 | 1 | |||||||
MIRT605197 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | ![]() |
1 | 1 | |||||||
MIRT605486 | Slc6a2 | solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 | ![]() |
1 | 1 | |||||||
MIRT605618 | Mpv17 | MpV17 mitochondrial inner membrane protein | ![]() |
1 | 1 | |||||||
MIRT606168 | Syt13 | synaptotagmin XIII | ![]() |
1 | 1 | |||||||
MIRT606224 | Rft1 | RFT1 homolog | ![]() |
1 | 1 | |||||||
MIRT606518 | BC026590 | family with sequence similarity 206, member A | ![]() |
1 | 1 |