miRNA Infomation
miRNA namemmu-miR-1186a

Gene Information
Gene Symbol Med16   
Synonyms 95kDa, A630083L04, Thrap5, Trap95
Description mediator complex subunit 16
Transcript NM_001163276   
Other Transcripts NM_198107   
Expression
Putative miRNA Targets on Med16
3'UTR of Med16
(miRNA target sites are highlighted)
>Med16|NM_001163276|3'UTR
   1 GCCACAGCCCACCAGCCTGCGTATGTACAACCAGTCTCTGAACATTGACATTGCTGTGCTCACTGAGGCACAAGTACCCA
  81 CCAATGGCCCCTGGGTCTGCCCCTTCTAGGGACATGCGGCATCTCTAGGGCCTGAAGTCCCATGGTCATATCCAAGCCAG
 161 TGTGAAGGAGCTGGGCTGTGTATTCATCCTTTAAAAGATCCACAGTGGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAG
 241 CACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGC
 321 TACACAGAGAAACCCTGTCTCGAAAAAACAAAACAAAAAAAAAAAAAGATTCACAGTACATAAAGCCCCTTGTCCTGCTT
 401 GGGGTCGTCTGCCTCAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCTCAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCT
 481 CAGTTTTCTTGTCCTGCTTGGGGTCGTCTGCCTCAGTTTTCTTTGGGTGCCGGTGGGAGGGGAAGACTGGCCCAATAAAG
 561 TTCTCTGATGCACTAGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
114 mmu-miR-1186a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT579774 Zfp568 zinc finger protein 568 1 1
MIRT580629 Sycp2 synaptonemal complex protein 2 1 1
MIRT582212 Nfatc3 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 1 1
MIRT582800 Kcnmb2 potassium large conductance calcium-activated channel, subfamily M, beta member 2 1 1
MIRT585391 Wfs1 wolframin ER transmembrane glycoprotein 1 2
MIRT589502 Myo1e myosin IE 1 2
MIRT589770 Itgb3 integrin beta 3 1 1
MIRT593622 Tstd2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 1 1
MIRT593854 Havcr2 hepatitis A virus cellular receptor 2 1 1
MIRT594849 Npm3 nucleoplasmin 3 1 1
MIRT596507 Zfp933 zinc finger protein 933 1 1
MIRT596526 Zfp882 zinc finger protein 882 1 1
MIRT596548 Zfp866 zinc finger protein 866 1 1
MIRT596772 Usp45 ubiquitin specific petidase 45 1 1
MIRT596785 Ubxn2a UBX domain protein 2A 1 1
MIRT596892 Trp53rk transformation related protein 53 regulating kinase B 1 1
MIRT596930 Tprkb Tp53rk binding protein 1 1
MIRT596959 Tmem88b transmembrane protein 88B 1 1
MIRT597152 Stxbp4 syntaxin binding protein 4 1 1
MIRT597426 Rp2h retinitis pigmentosa 2 homolog 1 1
MIRT597534 Rapgef4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT597584 Ptpn7 protein tyrosine phosphatase, non-receptor type 7 1 1
MIRT597695 Ppp2r3d protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta 1 1
MIRT598007 Npy1r neuropeptide Y receptor Y1 1 1
MIRT598031 Nol10 nucleolar protein 10 1 1
MIRT598115 Ncl nucleolin 1 1
MIRT598155 Mtif2 mitochondrial translational initiation factor 2 1 1
MIRT598268 Mettl2 methyltransferase like 2 1 1
MIRT598274 Med16 mediator complex subunit 16 1 1
MIRT598308 Mc1r melanocortin 1 receptor 1 1
MIRT598344 Mau2 MAU2 sister chromatid cohesion factor 1 1
MIRT598391 Magt1 magnesium transporter 1 1 1
MIRT598427 Lrrc14b leucine rich repeat containing 14B 1 1
MIRT598438 Lpl lipoprotein lipase 1 1
MIRT598663 Hpgds hematopoietic prostaglandin D synthase 1 1
MIRT598704 Haus2 HAUS augmin-like complex, subunit 2 1 1
MIRT598875 Glyctk glycerate kinase 1 1
MIRT598888 Glrx2 glutaredoxin 2 (thioltransferase) 1 1
MIRT598958 Gemin8 gem nuclear organelle associated protein 8 1 1
MIRT599163 Diap2 diaphanous related formin 2 1 1
MIRT599256 Tmem245 transmembrane protein 245 1 1
MIRT599387 Clmn calmin 1 1
MIRT599416 Chek2 checkpoint kinase 2 1 1
MIRT599521 Cbwd1 COBW domain containing 1 1 1
MIRT599544 Car5b carbonic anhydrase 5b, mitochondrial 1 1
MIRT599748 Anapc16 anaphase promoting complex subunit 16 1 1
MIRT599851 Adarb1 adenosine deaminase, RNA-specific, B1 1 1
MIRT599902 Acat1 acetyl-Coenzyme A acetyltransferase 1 1 1
MIRT599921 A830018L16Rik RIKEN cDNA A830018L16 gene 1 1
MIRT599997 4930579G24Rik RIKEN cDNA 4930579G24 gene 1 1
MIRT600230 Trim56 tripartite motif-containing 56 1 1
MIRT600272 Tns4 tensin 4 1 1
MIRT600359 Srrm4 serine/arginine repetitive matrix 4 1 1
MIRT600536 Pdzd2 PDZ domain containing 2 1 1
MIRT600568 Ociad2 OCIA domain containing 2 1 1
MIRT600688 Lrrc8e leucine rich repeat containing 8 family, member E 1 1
MIRT600869 Gad2 glutamic acid decarboxylase 2 1 1
MIRT600880 Gabpb2 GA repeat binding protein, beta 2 1 1
MIRT600957 Elf1 E74-like factor 1 1 1
MIRT601037 Cntn2 contactin 2 1 1
MIRT601117 Bri3bp Bri3 binding protein 1 1
MIRT601253 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT601372 Ybey ybeY metallopeptidase 1 1
MIRT601482 Tmod1 tropomodulin 1 1 1
MIRT601550 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT601675 Sco1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT601939 Ogdh oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT601945 Nwd1 NACHT and WD repeat domain containing 1 1 1
MIRT601976 Nav1 neuron navigator 1 1 1
MIRT602013 Mpp7 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) 1 1
MIRT602121 Kremen2 kringle containing transmembrane protein 2 1 1
MIRT602189 Hyal1 hyaluronoglucosaminidase 1 1 1
MIRT602215 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT602246 Grm1 glutamate receptor, metabotropic 1 1 1
MIRT602369 Fbxl3 F-box and leucine-rich repeat protein 3 1 1
MIRT602428 Ercc4 excision repair cross-complementing rodent repair deficiency, complementation group 4 1 1
MIRT602494 Dkc1 dyskeratosis congenita 1, dyskerin 1 1
MIRT602567 Csf2rb colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) 1 1
MIRT602597 Chrnb4 cholinergic receptor, nicotinic, beta polypeptide 4 1 1
MIRT602687 Camk4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT602764 Asxl2 additional sex combs like 2 (Drosophila) 1 1
MIRT602851 Abcd2 ATP-binding cassette, sub-family D (ALD), member 2 1 1
MIRT602908 2210016F16Rik RIKEN cDNA 2210016F16 gene 1 1
MIRT603036 Chic1 cysteine-rich hydrophobic domain 1 1 1
MIRT603112 Xcr1 chemokine (C motif) receptor 1 1 1
MIRT603146 Ubxn8 UBX domain protein 8 1 1
MIRT603156 Ubxn4 UBX domain protein 4 1 1
MIRT603435 Rpl7l1 ribosomal protein L7-like 1 1 1
MIRT603455 Rhbdl2 rhomboid, veinlet-like 2 (Drosophila) 1 1
MIRT603518 Pxmp4 peroxisomal membrane protein 4 1 1
MIRT603818 Kif5b kinesin family member 5B 1 1
MIRT603872 Il11 interleukin 11 1 1
MIRT603888 Il10rb interleukin 10 receptor, beta 1 1
MIRT603916 Hltf helicase-like transcription factor 1 1
MIRT603974 Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type 1 1
MIRT604054 Erich1 glutamate rich 1 1 1
MIRT604186 Cxcl11 chemokine (C-X-C motif) ligand 11 1 1
MIRT604293 Ccdc36 coiled-coil domain containing 36 1 1
MIRT604399 Aida axin interactor, dorsalization associated 1 1
MIRT604524 Ccdc167 coiled-coil domain containing 167 1 1
MIRT604531 Zmym5 zinc finger, MYM-type 5 1 1
MIRT604577 Trip4 thyroid hormone receptor interactor 4 1 1
MIRT604627 Syt11 synaptotagmin XI 1 1
MIRT604718 Samd8 sterile alpha motif domain containing 8 1 1
MIRT604761 Rab27a RAB27A, member RAS oncogene family 1 1
MIRT604851 Mprip myosin phosphatase Rho interacting protein 1 1
MIRT604966 Gga2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT605164 C030039L03Rik zinc finger protein 607B 1 1
MIRT605197 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1 1
MIRT605486 Slc6a2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 1 1
MIRT605618 Mpv17 MpV17 mitochondrial inner membrane protein 1 1
MIRT606168 Syt13 synaptotagmin XIII 1 1
MIRT606224 Rft1 RFT1 homolog 1 1
MIRT606518 BC026590 family with sequence similarity 206, member A 1 1

Error report submission