pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-486b |
Genomic Coordinates | chr8: 23142573 - 23142662 |
Description | Mus musculus miR-486b stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-486b-5p |
Sequence | 15| UCCUGUACUGAGCUGCCCCGAG |36 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |
---|---|
Gene Symbol | H2-Q4 |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A
HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
12 mmu-miR-486b-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT578873 | Fam129c | family with sequence similarity 129, member C | 1 | 1 | ||||||||
MIRT581057 | Shc4 | SHC (Src homology 2 domain containing) family, member 4 | 1 | 3 | ||||||||
MIRT590828 | Zcchc9 | zinc finger, CCHC domain containing 9 | 1 | 1 | ||||||||
MIRT592960 | Tns3 | tensin 3 | 1 | 1 | ||||||||
MIRT597070 | Tbc1d8b | TBC1 domain family, member 8B | 1 | 1 | ||||||||
MIRT598043 | Nkain3 | Na+/K+ transporting ATPase interacting 3 | 1 | 1 | ||||||||
MIRT598359 | Maoa | monoamine oxidase A | 1 | 1 | ||||||||
MIRT598721 | H2-Q4 | histocompatibility 2, Q region locus 4 | 1 | 1 | ||||||||
MIRT598799 | Gm7609 | predicted pseudogene 7609 | 1 | 1 | ||||||||
MIRT599804 | Aim2 | absent in melanoma 2 | 1 | 1 | ||||||||
MIRT601040 | Cnnm3 | cyclin M3 | 1 | 1 | ||||||||
MIRT606320 | Ms4a6c | membrane-spanning 4-domains, subfamily A, member 6C | 1 | 1 |