pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-149 |
Genomic Coordinates | chr1: 92850378 - 92850443 |
Synonyms | Mirn149, mmu-mir-149, Mir149 |
Description | Mus musculus miR-149 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-149-5p |
Sequence | 4| UCUGGCUCCGUGUCUUCACUCCC |26 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Ecd | ||||||||||||||||||||
Synonyms | 5730461K03Rik, Hsgt1 | ||||||||||||||||||||
Description | ecdysoneless homolog (Drosophila) | ||||||||||||||||||||
Transcript | NM_027475 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Ecd | |||||||||||||||||||||
3'UTR of Ecd (miRNA target sites are highlighted) |
>Ecd|NM_027475|3'UTR 1 AGGACTAGCCTGCACATCAGCCACCCTTCTCAGGAATAAACGACTCTTCATAAGCACGCCTTTAATCCCAGCACTCGGGA 81 GACAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTAGAAAATGAGTTCCAGGAGAGCCAGGGCTACACAGAG 161 AAACCCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAGAGCATCTGTCTTCTGTGCAGGTTTCAGAGTCCCCGGGCCAC 241 CGTCTCCCAAGTCCTGTGACCTGGACACCGATTCTCATGAGCTTGTTTGATTTGTTTTACATTTGCCCAGGACGGAATCT 321 CCATTGTAGTAAACCACTGTGCTGTTGGCTGTTGGTGTAATTCTGAATATTCAGTTTCTCCCTTAGGTATGTTCCTCCTC 401 TGGTCAGAATTCTAAGTTGGCAAAAATCCCATTTCATTCACTTTTTAATGAAATAGAAAGTGCTAAAACTTAGTGTTCAG 481 TCTGTGACATTCTGCACGCGCTCCTAATTGAGGGTAAGAACTTATTATTCCTTAATTAACAATTAAAGACATTAGCAGAC 561 AGACTGGGTCTGACTGAGGCATCTCACACCTGGGTACTTGCTTGGCTTCTGTCCCCTCCTCTACCCAGGCTGCCCTGCTT 641 CGTGTCTTTGTATATACATTTAAGTCTCAGTTCCACATGTAAGGAGATGTTCTTTTTTTGTCCTCTCTTGGTCCCCTCCC 721 CATTAATTCCCTTCTGGTTCCGTGTCACATTGTCACATTTACCTTTTTTTTTTTTTTTTTTGGTTTATTGAGAGTCTGTG 801 GCCAGGGTGGCCTCATATCTTCTGTTGTTGGAACACATTGAAGGAAATTGATTTTTTTTCATTTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
424 mmu-miR-149-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT005299 | Aicda | activation-induced cytidine deaminase | ![]() |
![]() |
2 | 1 | ||||||
MIRT014440 | Tspan7 | tetraspanin 7 | ![]() |
1 | 1 | |||||||
MIRT014441 | Ipcef1 | interaction protein for cytohesin exchange factors 1 | ![]() |
1 | 1 | |||||||
MIRT014442 | Macrod2 | MACRO domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014443 | Zkscan8 | zinc finger with KRAB and SCAN domains 8 | ![]() |
1 | 1 | |||||||
MIRT014444 | Vat1 | vesicle amine transport 1 | ![]() |
1 | 1 | |||||||
MIRT014445 | Kif1b | kinesin family member 1B | ![]() |
1 | 1 | |||||||
MIRT014446 | Sema4a | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A | ![]() |
1 | 1 | |||||||
MIRT014447 | Adamts16 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 | ![]() |
1 | 1 | |||||||
MIRT014448 | Ddx3x | DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked | ![]() |
1 | 1 | |||||||
MIRT014449 | Lpcat1 | lysophosphatidylcholine acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014450 | Mob1a | MOB kinase activator 1A | ![]() |
1 | 1 | |||||||
MIRT014451 | Opcml | opioid binding protein/cell adhesion molecule-like | ![]() |
1 | 1 | |||||||
MIRT014452 | Papola | poly (A) polymerase alpha | ![]() |
1 | 1 | |||||||
MIRT014453 | Uba2 | ubiquitin-like modifier activating enzyme 2 | ![]() |
1 | 1 | |||||||
MIRT014454 | Tmem127 | transmembrane protein 127 | ![]() |
1 | 1 | |||||||
MIRT014455 | Fut9 | fucosyltransferase 9 | ![]() |
1 | 1 | |||||||
MIRT014456 | Zer1 | zyg-11 related, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT014457 | Ptpn5 | protein tyrosine phosphatase, non-receptor type 5 | ![]() |
1 | 1 | |||||||
MIRT014458 | Ksr2 | kinase suppressor of ras 2 | ![]() |
1 | 1 | |||||||
MIRT014459 | Kcnj16 | potassium inwardly-rectifying channel, subfamily J, member 16 | ![]() |
1 | 1 | |||||||
MIRT014460 | Rgp1 | RAB6A GEF compex partner 1 | ![]() |
1 | 1 | |||||||
MIRT014461 | Nrgn | neurogranin | ![]() |
1 | 1 | |||||||
MIRT014462 | Elovl2 | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 | ![]() |
1 | 1 | |||||||
MIRT014463 | Zfp280d | zinc finger protein 280D | ![]() |
1 | 1 | |||||||
MIRT014464 | Prnp | prion protein | ![]() |
1 | 1 | |||||||
MIRT014465 | Ube2n | ubiquitin-conjugating enzyme E2N | ![]() |
1 | 1 | |||||||
MIRT014466 | Nptn | neuroplastin | ![]() |
1 | 1 | |||||||
MIRT014467 | Twsg1 | twisted gastrulation BMP signaling modulator 1 | ![]() |
1 | 1 | |||||||
MIRT014468 | Prrc2b | proline-rich coiled-coil 2B | ![]() |
1 | 1 | |||||||
MIRT014469 | Sdcbp | syndecan binding protein | ![]() |
1 | 1 | |||||||
MIRT014470 | Aldoc | aldolase C, fructose-bisphosphate | ![]() |
1 | 1 | |||||||
MIRT014471 | Smad7 | SMAD family member 7 | ![]() |
1 | 1 | |||||||
MIRT014472 | Cdadc1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014473 | Mfrp | membrane frizzled-related protein | ![]() |
1 | 1 | |||||||
MIRT014474 | Kit | KIT proto-oncogene receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT014475 | Ubr4 | ubiquitin protein ligase E3 component n-recognin 4 | ![]() |
1 | 1 | |||||||
MIRT014476 | Slc10a4 | solute carrier family 10 (sodium/bile acid cotransporter family), member 4 | ![]() |
1 | 1 | |||||||
MIRT014477 | Il1rap | interleukin 1 receptor accessory protein | ![]() |
1 | 1 | |||||||
MIRT014478 | Rsrc2 | arginine/serine-rich coiled-coil 2 | ![]() |
1 | 1 | |||||||
MIRT014479 | Luc7l3 | LUC7-like 3 (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT014480 | Nkrf | NF-kappaB repressing factor | ![]() |
1 | 1 | |||||||
MIRT014481 | Lfng | LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase | ![]() |
1 | 1 | |||||||
MIRT014482 | Btbd19 | BTB (POZ) domain containing 19 | ![]() |
1 | 1 | |||||||
MIRT014483 | Fam49b | family with sequence similarity 49, member B | ![]() |
1 | 1 | |||||||
MIRT014484 | Emc10 | ER membrane protein complex subunit 10 | ![]() |
1 | 1 | |||||||
MIRT014485 | Tpp1 | tripeptidyl peptidase I | ![]() |
1 | 1 | |||||||
MIRT014486 | Ptgfrn | prostaglandin F2 receptor negative regulator | ![]() |
1 | 1 | |||||||
MIRT014487 | Zbtb9 | zinc finger and BTB domain containing 9 | ![]() |
1 | 1 | |||||||
MIRT014488 | Crtc1 | CREB regulated transcription coactivator 1 | ![]() |
1 | 1 | |||||||
MIRT014489 | Rab14 | RAB14, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT014490 | Add3 | adducin 3 (gamma) | ![]() |
1 | 1 | |||||||
MIRT014491 | Cul1 | cullin 1 | ![]() |
1 | 1 | |||||||
MIRT014492 | Tmtc1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT014493 | Scn8a | sodium channel, voltage-gated, type VIII, alpha | ![]() |
1 | 1 | |||||||
MIRT014494 | Acot11 | acyl-CoA thioesterase 11 | ![]() |
1 | 1 | |||||||
MIRT014495 | Htr5a | 5-hydroxytryptamine (serotonin) receptor 5A | ![]() |
1 | 1 | |||||||
MIRT014496 | Ppp2r2c | protein phosphatase 2, regulatory subunit B, gamma | ![]() |
1 | 1 | |||||||
MIRT014497 | Ikbkg | inhibitor of kappaB kinase gamma | ![]() |
1 | 1 | |||||||
MIRT014498 | Bptf | bromodomain PHD finger transcription factor | ![]() |
1 | 1 | |||||||
MIRT014499 | Reep4 | receptor accessory protein 4 | ![]() |
1 | 1 | |||||||
MIRT014500 | Cxcl12 | chemokine (C-X-C motif) ligand 12 | ![]() |
1 | 1 | |||||||
MIRT014501 | Soat1 | sterol O-acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014502 | Gprc5b | G protein-coupled receptor, family C, group 5, member B | ![]() |
1 | 1 | |||||||
MIRT014503 | Btd | biotinidase | ![]() |
1 | 1 | |||||||
MIRT014504 | Ip6k1 | inositol hexaphosphate kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014505 | Arl5a | ADP-ribosylation factor-like 5A | ![]() |
1 | 1 | |||||||
MIRT014506 | Plekhh2 | pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 | ![]() |
1 | 1 | |||||||
MIRT014507 | Tex264 | testis expressed gene 264 | ![]() |
1 | 1 | |||||||
MIRT014508 | Gpc1 | glypican 1 | ![]() |
1 | 1 | |||||||
MIRT014509 | Nol10 | nucleolar protein 10 | ![]() |
1 | 3 | |||||||
MIRT014510 | Elmo1 | engulfment and cell motility 1 | ![]() |
1 | 1 | |||||||
MIRT014511 | Shisa6 | shisa family member 6 | ![]() |
1 | 1 | |||||||
MIRT014512 | Zbtb39 | zinc finger and BTB domain containing 39 | ![]() |
1 | 1 | |||||||
MIRT014513 | Cdr2l | cerebellar degeneration-related protein 2-like | ![]() |
1 | 1 | |||||||
MIRT014514 | Aagab | alpha- and gamma-adaptin binding protein | ![]() |
1 | 1 | |||||||
MIRT014515 | Nmnat2 | nicotinamide nucleotide adenylyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT014516 | Acvr1b | activin A receptor, type 1B | ![]() |
1 | 1 | |||||||
MIRT014517 | Vamp2 | vesicle-associated membrane protein 2 | ![]() |
1 | 1 | |||||||
MIRT014518 | Ctnnd1 | catenin (cadherin associated protein), delta 1 | ![]() |
1 | 1 | |||||||
MIRT014519 | Dpp8 | dipeptidylpeptidase 8 | ![]() |
1 | 1 | |||||||
MIRT014520 | Lhx1 | LIM homeobox protein 1 | ![]() |
1 | 1 | |||||||
MIRT014521 | Spred3 | sprouty-related, EVH1 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014522 | Foxn3 | forkhead box N3 | ![]() |
1 | 1 | |||||||
MIRT014523 | Ska3 | spindle and kinetochore associated complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014524 | Tnrc6b | trinucleotide repeat containing 6b | ![]() |
1 | 1 | |||||||
MIRT014525 | Setd7 | SET domain containing (lysine methyltransferase) 7 | ![]() |
1 | 1 | |||||||
MIRT014526 | Tcta | T cell leukemia translocation altered gene | ![]() |
1 | 1 | |||||||
MIRT014527 | Sez6 | seizure related gene 6 | ![]() |
1 | 1 | |||||||
MIRT014528 | Pafah1b2 | platelet-activating factor acetylhydrolase, isoform 1b, subunit 2 | ![]() |
1 | 1 | |||||||
MIRT014529 | Polr3f | polymerase (RNA) III (DNA directed) polypeptide F | ![]() |
1 | 1 | |||||||
MIRT014530 | Kifap3 | kinesin-associated protein 3 | ![]() |
1 | 1 | |||||||
MIRT014531 | Arhgef10 | Rho guanine nucleotide exchange factor (GEF) 10 | ![]() |
1 | 1 | |||||||
MIRT014532 | B3galt5 | UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 | ![]() |
1 | 1 | |||||||
MIRT014533 | Kcnj3 | potassium inwardly-rectifying channel, subfamily J, member 3 | ![]() |
1 | 1 | |||||||
MIRT014534 | Lpin1 | lipin 1 | ![]() |
1 | 1 | |||||||
MIRT014535 | Syt6 | synaptotagmin VI | ![]() |
1 | 1 | |||||||
MIRT014536 | Ephb3 | Eph receptor B3 | ![]() |
1 | 5 | |||||||
MIRT014537 | Dbx2 | developing brain homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT014538 | Vldlr | very low density lipoprotein receptor | ![]() |
1 | 1 | |||||||
MIRT014539 | Sema4g | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G | ![]() |
1 | 1 | |||||||
MIRT014540 | BC034090 | cDNA sequence BC034090 | ![]() |
1 | 1 | |||||||
MIRT014541 | Sash1 | SAM and SH3 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014542 | Ttc3 | tetratricopeptide repeat domain 3 | ![]() |
1 | 1 | |||||||
MIRT014543 | Flrt1 | fibronectin leucine rich transmembrane protein 1 | ![]() |
1 | 1 | |||||||
MIRT014544 | Hnrnpa1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
1 | 1 | |||||||
MIRT014545 | Rdx | radixin | ![]() |
1 | 1 | |||||||
MIRT014546 | Mapk9 | mitogen-activated protein kinase 9 | ![]() |
1 | 1 | |||||||
MIRT014547 | Grm1 | glutamate receptor, metabotropic 1 | ![]() |
1 | 1 | |||||||
MIRT014548 | Mvb12b | multivesicular body subunit 12B | ![]() |
1 | 1 | |||||||
MIRT014549 | Cpox | coproporphyrinogen oxidase | ![]() |
1 | 1 | |||||||
MIRT014550 | Gtf2i | general transcription factor II I | ![]() |
1 | 1 | |||||||
MIRT014551 | Tinf2 | Terf1 (TRF1)-interacting nuclear factor 2 | ![]() |
1 | 1 | |||||||
MIRT014552 | Snhg11 | small nucleolar RNA host gene 11 | ![]() |
1 | 1 | |||||||
MIRT014553 | Rragc | Ras-related GTP binding C | ![]() |
1 | 1 | |||||||
MIRT014554 | Pde7b | phosphodiesterase 7B | ![]() |
1 | 1 | |||||||
MIRT014555 | Gab1 | growth factor receptor bound protein 2-associated protein 1 | ![]() |
1 | 1 | |||||||
MIRT014556 | Fabp7 | fatty acid binding protein 7, brain | ![]() |
1 | 1 | |||||||
MIRT014557 | Gprc5c | G protein-coupled receptor, family C, group 5, member C | ![]() |
1 | 1 | |||||||
MIRT014558 | Furin | furin (paired basic amino acid cleaving enzyme) | ![]() |
1 | 1 | |||||||
MIRT014559 | Rnf144a | ring finger protein 144A | ![]() |
1 | 1 | |||||||
MIRT014560 | Cant1 | calcium activated nucleotidase 1 | ![]() |
1 | 1 | |||||||
MIRT014561 | Nrep | neuronal regeneration related protein | ![]() |
1 | 1 | |||||||
MIRT014562 | Il6st | interleukin 6 signal transducer | ![]() |
1 | 1 | |||||||
MIRT014563 | F3 | coagulation factor III | ![]() |
1 | 1 | |||||||
MIRT014564 | 1190002N15Rik | RIKEN cDNA 1190002N15 gene | ![]() |
1 | 1 | |||||||
MIRT014565 | Mdm4 | transformed mouse 3T3 cell double minute 4 | ![]() |
1 | 1 | |||||||
MIRT014566 | Lmbrd1 | LMBR1 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014567 | Sf3b3 | splicing factor 3b, subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014568 | Ptprd | protein tyrosine phosphatase, receptor type, D | ![]() |
1 | 1 | |||||||
MIRT014569 | Ikbkap | inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein | ![]() |
1 | 1 | |||||||
MIRT014570 | Slc7a1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | ![]() |
1 | 1 | |||||||
MIRT014571 | Camta1 | calmodulin binding transcription activator 1 | ![]() |
1 | 1 | |||||||
MIRT014572 | Irak1 | interleukin-1 receptor-associated kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014573 | Pccb | propionyl Coenzyme A carboxylase, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014574 | Neto2 | neuropilin (NRP) and tolloid (TLL)-like 2 | ![]() |
1 | 1 | |||||||
MIRT014575 | Map3k14 | mitogen-activated protein kinase kinase kinase 14 | ![]() |
1 | 1 | |||||||
MIRT014576 | Scn4b | sodium channel, type IV, beta | ![]() |
1 | 1 | |||||||
MIRT014577 | Trib2 | tribbles pseudokinase 2 | ![]() |
1 | 1 | |||||||
MIRT014578 | Git2 | G protein-coupled receptor kinase-interactor 2 | ![]() |
1 | 1 | |||||||
MIRT014579 | Reep1 | receptor accessory protein 1 | ![]() |
1 | 1 | |||||||
MIRT014580 | Atg5 | autophagy related 5 | ![]() |
1 | 1 | |||||||
MIRT014581 | Gng7 | guanine nucleotide binding protein (G protein), gamma 7 | ![]() |
1 | 1 | |||||||
MIRT014582 | Fem1b | feminization 1 homolog b (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT014583 | Trak2 | trafficking protein, kinesin binding 2 | ![]() |
1 | 1 | |||||||
MIRT014584 | Gnao1 | guanine nucleotide binding protein, alpha O | ![]() |
1 | 1 | |||||||
MIRT014585 | Dpy19l3 | dpy-19-like 3 (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT014586 | Ptpn12 | protein tyrosine phosphatase, non-receptor type 12 | ![]() |
1 | 1 | |||||||
MIRT014587 | Wdr1 | WD repeat domain 1 | ![]() |
1 | 1 | |||||||
MIRT014588 | Pofut1 | protein O-fucosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014589 | Usp48 | ubiquitin specific peptidase 48 | ![]() |
1 | 1 | |||||||
MIRT014590 | Cxadr | coxsackie virus and adenovirus receptor | ![]() |
1 | 1 | |||||||
MIRT014591 | Lrrc58 | leucine rich repeat containing 58 | ![]() |
1 | 1 | |||||||
MIRT014592 | R3hdm1 | R3H domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014593 | 4933426M11Rik | sushi domain containing 6 | ![]() |
1 | 1 | |||||||
MIRT014594 | Med10 | mediator complex subunit 10 | ![]() |
1 | 1 | |||||||
MIRT014595 | Sptbn2 | spectrin beta, non-erythrocytic 2 | ![]() |
1 | 1 | |||||||
MIRT014596 | 8430419L09Rik | family with sequence similarity 234, member B | ![]() |
1 | 1 | |||||||
MIRT014597 | Kcnc1 | potassium voltage gated channel, Shaw-related subfamily, member 1 | ![]() |
1 | 1 | |||||||
MIRT014598 | Dgcr2 | DiGeorge syndrome critical region gene 2 | ![]() |
1 | 1 | |||||||
MIRT014599 | Mtmr12 | myotubularin related protein 12 | ![]() |
1 | 1 | |||||||
MIRT014600 | Txnip | thioredoxin interacting protein | ![]() |
1 | 1 | |||||||
MIRT014601 | Slc39a3 | solute carrier family 39 (zinc transporter), member 3 | ![]() |
1 | 1 | |||||||
MIRT014602 | Itsn1 | intersectin 1 (SH3 domain protein 1A) | ![]() |
1 | 1 | |||||||
MIRT014603 | Efcab14 | EF-hand calcium binding domain 14 | ![]() |
1 | 1 | |||||||
MIRT014604 | Csnk1a1 | casein kinase 1, alpha 1 | ![]() |
1 | 1 | |||||||
MIRT014605 | Gria1 | glutamate receptor, ionotropic, AMPA1 (alpha 1) | ![]() |
1 | 1 | |||||||
MIRT014606 | Zfp605 | zinc finger protein 605 | ![]() |
1 | 1 | |||||||
MIRT014607 | Cnot6 | CCR4-NOT transcription complex, subunit 6 | ![]() |
1 | 1 | |||||||
MIRT014608 | Paqr4 | progestin and adipoQ receptor family member IV | ![]() |
1 | 1 | |||||||
MIRT014609 | Unc5b | unc-5 netrin receptor B | ![]() |
1 | 1 | |||||||
MIRT014610 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT014611 | Zcchc4 | zinc finger, CCHC domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014612 | Fam102a | family with sequence similarity 102, member A | ![]() |
1 | 1 | |||||||
MIRT014613 | Plekha2 | pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 | ![]() |
1 | 1 | |||||||
MIRT014614 | Tmem135 | transmembrane protein 135 | ![]() |
1 | 1 | |||||||
MIRT014615 | Tmem8b | transmembrane protein 8B | ![]() |
1 | 1 | |||||||
MIRT014616 | Ccser2 | coiled-coil serine rich 2 | ![]() |
1 | 1 | |||||||
MIRT014617 | Sdc3 | syndecan 3 | ![]() |
1 | 1 | |||||||
MIRT014618 | Braf | Braf transforming gene | ![]() |
1 | 1 | |||||||
MIRT014619 | Pno1 | partner of NOB1 homolog | ![]() |
1 | 1 | |||||||
MIRT014620 | Bahcc1 | BAH domain and coiled-coil containing 1 | ![]() |
1 | 1 | |||||||
MIRT014621 | Gramd1b | GRAM domain containing 1B | ![]() |
1 | 1 | |||||||
MIRT014622 | Prkab1 | protein kinase, AMP-activated, beta 1 non-catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT014623 | Plec | plectin | ![]() |
1 | 1 | |||||||
MIRT014624 | Rap2a | RAS related protein 2a | ![]() |
1 | 1 | |||||||
MIRT014625 | Rhbdd2 | rhomboid domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014626 | Sertad2 | SERTA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014627 | Entpd7 | ectonucleoside triphosphate diphosphohydrolase 7 | ![]() |
1 | 1 | |||||||
MIRT014628 | Efr3b | EFR3 homolog B | ![]() |
1 | 1 | |||||||
MIRT014629 | Gabrb2 | gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 | ![]() |
1 | 1 | |||||||
MIRT014630 | Atp2a2 | ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | ![]() |
1 | 1 | |||||||
MIRT014631 | Fnbp1 | formin binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT014632 | Dab2ip | disabled 2 interacting protein | ![]() |
1 | 1 | |||||||
MIRT014633 | Snx27 | sorting nexin family member 27 | ![]() |
1 | 1 | |||||||
MIRT014634 | Hmg20a | high mobility group 20A | ![]() |
1 | 1 | |||||||
MIRT014635 | Rab3gap1 | RAB3 GTPase activating protein subunit 1 | ![]() |
1 | 1 | |||||||
MIRT014636 | Epb4.1l1 | erythrocyte membrane protein band 4.1 like 1 | ![]() |
1 | 1 | |||||||
MIRT014637 | Epha4 | Eph receptor A4 | ![]() |
1 | 1 | |||||||
MIRT014638 | Bach1 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | ![]() |
1 | 1 | |||||||
MIRT014639 | Rab6b | RAB6B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT014640 | 6030458C11Rik | RIKEN cDNA 6030458C11 gene | ![]() |
1 | 1 | |||||||
MIRT014641 | Zbtb4 | zinc finger and BTB domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014642 | Cbx5 | chromobox 5 | ![]() |
1 | 1 | |||||||
MIRT014643 | Eif5a | eukaryotic translation initiation factor 5A | ![]() |
1 | 1 | |||||||
MIRT014644 | Slc37a3 | solute carrier family 37 (glycerol-3-phosphate transporter), member 3 | ![]() |
1 | 1 | |||||||
MIRT014645 | Rcc2 | regulator of chromosome condensation 2 | ![]() |
1 | 1 | |||||||
MIRT014646 | Caln1 | calneuron 1 | ![]() |
1 | 1 | |||||||
MIRT014647 | Frem2 | Fras1 related extracellular matrix protein 2 | ![]() |
1 | 1 | |||||||
MIRT014648 | Clp1 | CLP1, cleavage and polyadenylation factor I subunit | ![]() |
1 | 1 | |||||||
MIRT014649 | Ablim1 | actin-binding LIM protein 1 | ![]() |
1 | 1 | |||||||
MIRT014650 | Krba1 | KRAB-A domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014651 | Sec14l1 | SEC14-like lipid binding 1 | ![]() |
1 | 1 | |||||||
MIRT014652 | Ywhab | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014653 | Bcas3 | breast carcinoma amplified sequence 3 | ![]() |
1 | 1 | |||||||
MIRT014654 | Celf5 | CUGBP, Elav-like family member 5 | ![]() |
1 | 1 | |||||||
MIRT014655 | Atad2 | ATPase family, AAA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014656 | Nptx1 | neuronal pentraxin 1 | ![]() |
1 | 1 | |||||||
MIRT014657 | Mmp15 | matrix metallopeptidase 15 | ![]() |
1 | 1 | |||||||
MIRT014658 | Crkl | v-crk avian sarcoma virus CT10 oncogene homolog-like | ![]() |
1 | 1 | |||||||
MIRT014659 | Pigq | phosphatidylinositol glycan anchor biosynthesis, class Q | ![]() |
1 | 1 | |||||||
MIRT014660 | Akt1 | thymoma viral proto-oncogene 1 | ![]() |
1 | 1 | |||||||
MIRT014661 | Zmat3 | zinc finger matrin type 3 | ![]() |
1 | 1 | |||||||
MIRT014662 | Cds2 | CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 | ![]() |
1 | 1 | |||||||
MIRT014663 | Nhsl1 | NHS-like 1 | ![]() |
1 | 1 | |||||||
MIRT014664 | Poglut1 | protein O-glucosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014665 | Slc35e2 | solute carrier family 35, member E2 | ![]() |
1 | 1 | |||||||
MIRT014666 | Cep95 | centrosomal protein 95 | ![]() |
1 | 1 | |||||||
MIRT014667 | 2510039O18Rik | RIKEN cDNA 2510039O18 gene | ![]() |
1 | 1 | |||||||
MIRT014668 | Dhcr24 | 24-dehydrocholesterol reductase | ![]() |
1 | 1 | |||||||
MIRT014669 | Arid4b | AT rich interactive domain 4B (RBP1-like) | ![]() |
1 | 1 | |||||||
MIRT014670 | Iws1 | IWS1, SUPT6 interacting protein | ![]() |
1 | 1 | |||||||
MIRT014671 | Ifngr2 | interferon gamma receptor 2 | ![]() |
1 | 1 | |||||||
MIRT014672 | Zfp251 | zinc finger protein 251 | ![]() |
1 | 1 | |||||||
MIRT014673 | Med26 | mediator complex subunit 26 | ![]() |
1 | 1 | |||||||
MIRT014674 | Reck | reversion-inducing-cysteine-rich protein with kazal motifs | ![]() |
1 | 1 | |||||||
MIRT014675 | Bicd2 | bicaudal D homolog 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT014676 | Tmbim6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
1 | 1 | |||||||
MIRT014677 | Cdk13 | cyclin-dependent kinase 13 | ![]() |
1 | 1 | |||||||
MIRT014678 | Rapgef4 | Rap guanine nucleotide exchange factor (GEF) 4 | ![]() |
1 | 1 | |||||||
MIRT014679 | Trank1 | tetratricopeptide repeat and ankyrin repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT014680 | Stam2 | signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 | ![]() |
1 | 1 | |||||||
MIRT014681 | Ppp1r1a | protein phosphatase 1, regulatory (inhibitor) subunit 1A | ![]() |
1 | 1 | |||||||
MIRT014682 | Thsd4 | thrombospondin, type I, domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014683 | Cadm2 | cell adhesion molecule 2 | ![]() |
1 | 1 | |||||||
MIRT014684 | Slc6a17 | solute carrier family 6 (neurotransmitter transporter), member 17 | ![]() |
1 | 1 | |||||||
MIRT014685 | Sestd1 | SEC14 and spectrin domains 1 | ![]() |
1 | 1 | |||||||
MIRT014686 | Tbc1d20 | TBC1 domain family, member 20 | ![]() |
1 | 1 | |||||||
MIRT014687 | Per2 | period circadian clock 2 | ![]() |
1 | 1 | |||||||
MIRT014688 | Ugcg | UDP-glucose ceramide glucosyltransferase | ![]() |
1 | 1 | |||||||
MIRT014689 | Ric3 | RIC3 acetylcholine receptor chaperone | ![]() |
1 | 1 | |||||||
MIRT014690 | Usp10 | ubiquitin specific peptidase 10 | ![]() |
1 | 1 | |||||||
MIRT014691 | Macf1 | microtubule-actin crosslinking factor 1 | ![]() |
1 | 1 | |||||||
MIRT014692 | Adck4 | coenzyme Q8B | ![]() |
1 | 1 | |||||||
MIRT014693 | Tef | thyrotroph embryonic factor | ![]() |
1 | 1 | |||||||
MIRT014694 | Slc24a3 | solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 | ![]() |
1 | 1 | |||||||
MIRT014695 | Ccdc43 | coiled-coil domain containing 43 | ![]() |
1 | 1 | |||||||
MIRT014696 | Nf1 | neurofibromin 1 | ![]() |
1 | 1 | |||||||
MIRT014697 | Hip1 | huntingtin interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT014698 | Ptpn11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
1 | 1 | |||||||
MIRT014699 | Wnk1 | WNK lysine deficient protein kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014700 | Lmtk2 | lemur tyrosine kinase 2 | ![]() |
1 | 1 | |||||||
MIRT014701 | Synj1 | synaptojanin 1 | ![]() |
1 | 1 | |||||||
MIRT014702 | Clmp | CXADR-like membrane protein | ![]() |
1 | 1 | |||||||
MIRT014703 | Slc22a23 | solute carrier family 22, member 23 | ![]() |
1 | 1 | |||||||
MIRT014704 | Otud7b | OTU domain containing 7B | ![]() |
1 | 1 | |||||||
MIRT014705 | Slc1a1 | solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 | ![]() |
1 | 1 | |||||||
MIRT014706 | Astn1 | astrotactin 1 | ![]() |
1 | 1 | |||||||
MIRT014707 | Stk38 | serine/threonine kinase 38 | ![]() |
1 | 1 | |||||||
MIRT014708 | BC026590 | family with sequence similarity 206, member A | ![]() |
1 | 1 | |||||||
MIRT014709 | Fam102b | family with sequence similarity 102, member B | ![]() |
1 | 1 | |||||||
MIRT014710 | Rictor | RPTOR independent companion of MTOR, complex 2 | ![]() |
1 | 1 | |||||||
MIRT014711 | Ntrk2 | neurotrophic tyrosine kinase, receptor, type 2 | ![]() |
1 | 1 | |||||||
MIRT014712 | Phka1 | phosphorylase kinase alpha 1 | ![]() |
1 | 1 | |||||||
MIRT014713 | Gpr89 | G protein-coupled receptor 89 | ![]() |
1 | 1 | |||||||
MIRT014714 | Cdk19 | cyclin-dependent kinase 19 | ![]() |
1 | 1 | |||||||
MIRT014715 | Kansl3 | KAT8 regulatory NSL complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014716 | Kcnk6 | potassium inwardly-rectifying channel, subfamily K, member 6 | ![]() |
1 | 2 | |||||||
MIRT014717 | Rnf169 | ring finger protein 169 | ![]() |
1 | 1 | |||||||
MIRT014718 | Sart1 | squamous cell carcinoma antigen recognized by T cells 1 | ![]() |
1 | 1 | |||||||
MIRT014719 | Ralgapa2 | Ral GTPase activating protein, alpha subunit 2 (catalytic) | ![]() |
1 | 1 | |||||||
MIRT014720 | Fam219a | family with sequence similarity 219, member A | ![]() |
1 | 1 | |||||||
MIRT014721 | Antxr1 | anthrax toxin receptor 1 | ![]() |
1 | 1 | |||||||
MIRT014722 | Scn1a | sodium channel, voltage-gated, type I, alpha | ![]() |
1 | 1 | |||||||
MIRT014723 | Cog3 | component of oligomeric golgi complex 3 | ![]() |
1 | 1 | |||||||
MIRT014724 | Scamp5 | secretory carrier membrane protein 5 | ![]() |
1 | 1 | |||||||
MIRT014725 | Zfyve27 | zinc finger, FYVE domain containing 27 | ![]() |
1 | 1 | |||||||
MIRT014726 | Mecp2 | methyl CpG binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT014727 | Gpr17 | G protein-coupled receptor 17 | ![]() |
1 | 1 | |||||||
MIRT014728 | Dusp16 | dual specificity phosphatase 16 | ![]() |
1 | 1 | |||||||
MIRT014729 | Nt5dc3 | 5'-nucleotidase domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014730 | Cbx1 | chromobox 1 | ![]() |
1 | 1 | |||||||
MIRT014731 | 2700089E24Rik | small integral membrane protein 10 like 1 | ![]() |
1 | 1 | |||||||
MIRT014732 | Syt2 | synaptotagmin II | ![]() |
1 | 1 | |||||||
MIRT014733 | Sik3 | SIK family kinase 3 | ![]() |
1 | 1 | |||||||
MIRT014734 | Asxl2 | additional sex combs like 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT014735 | Fkbp1b | FK506 binding protein 1b | ![]() |
1 | 1 | |||||||
MIRT014736 | Adcy1 | adenylate cyclase 1 | ![]() |
1 | 1 | |||||||
MIRT014737 | Nfix | nuclear factor I/X | ![]() |
1 | 1 | |||||||
MIRT014738 | Pea15a | phosphoprotein enriched in astrocytes 15A | ![]() |
1 | 1 | |||||||
MIRT014739 | Nrp2 | neuropilin 2 | ![]() |
1 | 1 | |||||||
MIRT014740 | N4bp1 | NEDD4 binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT014741 | Elfn1 | leucine rich repeat and fibronectin type III, extracellular 1 | ![]() |
1 | 1 | |||||||
MIRT014742 | Mtch1 | mitochondrial carrier 1 | ![]() |
1 | 1 | |||||||
MIRT014743 | Atad3a | ATPase family, AAA domain containing 3A | ![]() |
1 | 1 | |||||||
MIRT014744 | St8sia3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | ![]() |
1 | 1 | |||||||
MIRT014745 | Ulk1 | unc-51 like kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014746 | Zfp354c | zinc finger protein 354C | ![]() |
1 | 1 | |||||||
MIRT014747 | Rsbn1 | rosbin, round spermatid basic protein 1 | ![]() |
1 | 1 | |||||||
MIRT014748 | Calr | calreticulin | ![]() |
1 | 1 | |||||||
MIRT014749 | Tmod2 | tropomodulin 2 | ![]() |
1 | 1 | |||||||
MIRT014750 | Nedd4 | neural precursor cell expressed, developmentally down-regulated 4 | ![]() |
1 | 1 | |||||||
MIRT014751 | Coa3 | cytochrome C oxidase assembly factor 3 | ![]() |
1 | 1 | |||||||
MIRT014752 | Pdgfrb | platelet derived growth factor receptor, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014753 | Slc30a4 | solute carrier family 30 (zinc transporter), member 4 | ![]() |
1 | 1 | |||||||
MIRT014754 | Adar | adenosine deaminase, RNA-specific | ![]() |
1 | 1 | |||||||
MIRT014755 | Ywhag | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | ![]() |
1 | 1 | |||||||
MIRT014756 | Scd2 | stearoyl-Coenzyme A desaturase 2 | ![]() |
1 | 1 | |||||||
MIRT014757 | Zfp445 | zinc finger protein 445 | ![]() |
1 | 1 | |||||||
MIRT014758 | Rfx5 | regulatory factor X, 5 (influences HLA class II expression) | ![]() |
1 | 1 | |||||||
MIRT014759 | Igfbp7 | insulin-like growth factor binding protein 7 | ![]() |
1 | 1 | |||||||
MIRT014760 | Tmem109 | transmembrane protein 109 | ![]() |
1 | 1 | |||||||
MIRT014761 | Fem1c | fem-1 homolog c (C.elegans) | ![]() |
1 | 1 | |||||||
MIRT014762 | Mmp17 | matrix metallopeptidase 17 | ![]() |
1 | 1 | |||||||
MIRT014763 | Gxylt1 | glucoside xylosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014764 | Cbln1 | cerebellin 1 precursor protein | ![]() |
1 | 1 | |||||||
MIRT014765 | Ube2i | ubiquitin-conjugating enzyme E2I | ![]() |
1 | 1 | |||||||
MIRT014766 | Trp53inp2 | transformation related protein 53 inducible nuclear protein 2 | ![]() |
1 | 1 | |||||||
MIRT014767 | Efna5 | ephrin A5 | ![]() |
1 | 1 | |||||||
MIRT014768 | Gpr68 | G protein-coupled receptor 68 | ![]() |
1 | 1 | |||||||
MIRT014769 | Rad51c | RAD51 paralog C | ![]() |
1 | 1 | |||||||
MIRT014770 | Camk1g | calcium/calmodulin-dependent protein kinase I gamma | ![]() |
1 | 1 | |||||||
MIRT014771 | Entpd6 | ectonucleoside triphosphate diphosphohydrolase 6 | ![]() |
1 | 1 | |||||||
MIRT014772 | Osbpl8 | oxysterol binding protein-like 8 | ![]() |
1 | 1 | |||||||
MIRT014773 | Inpp5b | inositol polyphosphate-5-phosphatase B | ![]() |
1 | 1 | |||||||
MIRT014774 | Hspg2 | perlecan (heparan sulfate proteoglycan 2) | ![]() |
1 | 1 | |||||||
MIRT014775 | Ahcyl1 | S-adenosylhomocysteine hydrolase-like 1 | ![]() |
1 | 1 | |||||||
MIRT014776 | Zcchc24 | zinc finger, CCHC domain containing 24 | ![]() |
1 | 1 | |||||||
MIRT014777 | Syt11 | synaptotagmin XI | ![]() |
1 | 1 | |||||||
MIRT014778 | Tmem2 | transmembrane protein 2 | ![]() |
1 | 1 | |||||||
MIRT014779 | Bsdc1 | BSD domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014780 | Srrm2 | serine/arginine repetitive matrix 2 | ![]() |
1 | 1 | |||||||
MIRT014781 | Ank2 | ankyrin 2, brain | ![]() |
1 | 1 | |||||||
MIRT014782 | Slc15a4 | solute carrier family 15, member 4 | ![]() |
1 | 1 | |||||||
MIRT014783 | Tomm70a | translocase of outer mitochondrial membrane 70 homolog A (yeast) | ![]() |
1 | 1 | |||||||
MIRT014784 | Mid2 | midline 2 | ![]() |
1 | 1 | |||||||
MIRT014785 | Zbtb41 | zinc finger and BTB domain containing 41 | ![]() |
1 | 1 | |||||||
MIRT014786 | Nlgn3 | neuroligin 3 | ![]() |
1 | 1 | |||||||
MIRT014787 | Aldh9a1 | aldehyde dehydrogenase 9, subfamily A1 | ![]() |
1 | 1 | |||||||
MIRT014788 | Slc6a6 | solute carrier family 6 (neurotransmitter transporter, taurine), member 6 | ![]() |
1 | 1 | |||||||
MIRT014789 | Slc30a7 | solute carrier family 30 (zinc transporter), member 7 | ![]() |
1 | 1 | |||||||
MIRT014790 | Lmf2 | lipase maturation factor 2 | ![]() |
1 | 1 | |||||||
MIRT014791 | Slc44a2 | solute carrier family 44, member 2 | ![]() |
1 | 1 | |||||||
MIRT014792 | Dazap2 | DAZ associated protein 2 | ![]() |
1 | 1 | |||||||
MIRT014793 | Capns1 | calpain, small subunit 1 | ![]() |
1 | 1 | |||||||
MIRT014794 | Nr1d2 | nuclear receptor subfamily 1, group D, member 2 | ![]() |
1 | 1 | |||||||
MIRT014795 | Pnkd | paroxysmal nonkinesiogenic dyskinesia | ![]() |
1 | 1 | |||||||
MIRT014796 | Rnf165 | ring finger protein 165 | ![]() |
1 | 1 | |||||||
MIRT014797 | Myo10 | myosin X | ![]() |
1 | 1 | |||||||
MIRT014798 | Tnrc6a | trinucleotide repeat containing 6a | ![]() |
1 | 1 | |||||||
MIRT014799 | Mbp | myelin basic protein | ![]() |
1 | 1 | |||||||
MIRT014800 | Hic2 | hypermethylated in cancer 2 | ![]() |
1 | 1 | |||||||
MIRT014801 | Rap1gap2 | RAP1 GTPase activating protein 2 | ![]() |
1 | 1 | |||||||
MIRT014802 | Nfia | nuclear factor I/A | ![]() |
1 | 1 | |||||||
MIRT014803 | Sept8 | septin 8 | ![]() |
1 | 1 | |||||||
MIRT014804 | Elf2 | E74-like factor 2 | ![]() |
1 | 1 | |||||||
MIRT014805 | Zzz3 | zinc finger, ZZ domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014806 | Edem1 | ER degradation enhancer, mannosidase alpha-like 1 | ![]() |
1 | 1 | |||||||
MIRT014807 | Atrn | attractin | ![]() |
1 | 1 | |||||||
MIRT014808 | Csdc2 | cold shock domain containing C2, RNA binding | ![]() |
1 | 1 | |||||||
MIRT014809 | Timp3 | tissue inhibitor of metalloproteinase 3 | ![]() |
1 | 1 | |||||||
MIRT014810 | Ddit4 | DNA-damage-inducible transcript 4 | ![]() |
1 | 1 | |||||||
MIRT014811 | Dok1 | docking protein 1 | ![]() |
1 | 1 | |||||||
MIRT014812 | Slc43a2 | solute carrier family 43, member 2 | ![]() |
1 | 1 | |||||||
MIRT014813 | Zkscan1 | zinc finger with KRAB and SCAN domains 1 | ![]() |
1 | 1 | |||||||
MIRT014814 | Ptpn4 | protein tyrosine phosphatase, non-receptor type 4 | ![]() |
1 | 1 | |||||||
MIRT014815 | Ssbp2 | single-stranded DNA binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT014816 | Igfbp5 | insulin-like growth factor binding protein 5 | ![]() |
1 | 1 | |||||||
MIRT014817 | Naa40 | N(alpha)-acetyltransferase 40, NatD catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT014818 | Elovl5 | ELOVL family member 5, elongation of long chain fatty acids (yeast) | ![]() |
1 | 1 | |||||||
MIRT014819 | Ttyh3 | tweety family member 3 | ![]() |
1 | 1 | |||||||
MIRT014820 | Arc | activity regulated cytoskeletal-associated protein | ![]() |
1 | 1 | |||||||
MIRT014821 | Kcnj10 | potassium inwardly-rectifying channel, subfamily J, member 10 | ![]() |
1 | 1 | |||||||
MIRT014822 | Gm608 | upstream transcription factor family member 3 | ![]() |
1 | 1 | |||||||
MIRT014823 | Itpa | inosine triphosphatase (nucleoside triphosphate pyrophosphatase) | ![]() |
1 | 1 | |||||||
MIRT014824 | Slc6a8 | solute carrier family 6 (neurotransmitter transporter, creatine), member 8 | ![]() |
1 | 1 | |||||||
MIRT014825 | Ppap2b | phospholipid phosphatase 3 | ![]() |
1 | 1 | |||||||
MIRT014826 | Prickle2 | prickle planar cell polarity protein 2 | ![]() |
1 | 1 | |||||||
MIRT014827 | Wwtr1 | WW domain containing transcription regulator 1 | ![]() |
1 | 1 | |||||||
MIRT014828 | Ncoa5 | nuclear receptor coactivator 5 | ![]() |
1 | 1 | |||||||
MIRT014829 | Brap | BRCA1 associated protein | ![]() |
1 | 1 | |||||||
MIRT014830 | Tnks | tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase | ![]() |
1 | 1 | |||||||
MIRT014831 | Plxna2 | plexin A2 | ![]() |
1 | 1 | |||||||
MIRT014832 | Camk2g | calcium/calmodulin-dependent protein kinase II gamma | ![]() |
1 | 1 | |||||||
MIRT014833 | Klf7 | Kruppel-like factor 7 (ubiquitous) | ![]() |
1 | 1 | |||||||
MIRT014834 | Rnf24 | ring finger protein 24 | ![]() |
1 | 1 | |||||||
MIRT014835 | Fbxl16 | F-box and leucine-rich repeat protein 16 | ![]() |
1 | 4 | |||||||
MIRT014836 | Gria3 | glutamate receptor, ionotropic, AMPA3 (alpha 3) | ![]() |
1 | 1 | |||||||
MIRT579316 | BC003965 | cDNA sequence BC003965 | ![]() |
1 | 2 | |||||||
MIRT579432 | Adsl | adenylosuccinate lyase | ![]() |
1 | 1 | |||||||
MIRT579655 | 2010012O05Rik | BLOC-1 related complex subunit 7 | ![]() |
1 | 3 | |||||||
MIRT582543 | Map3k7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
1 | 1 | |||||||
MIRT585596 | Tns4 | tensin 4 | ![]() |
1 | 1 | |||||||
MIRT585774 | Speer4b | spermatogenesis associated glutamate (E)-rich protein 4B | ![]() |
1 | 1 | |||||||
MIRT586832 | Il5ra | interleukin 5 receptor, alpha | ![]() |
1 | 1 | |||||||
MIRT587885 | BC030476 | glutamate rich 5 | ![]() |
1 | 2 | |||||||
MIRT588274 | Sppl2a | signal peptide peptidase like 2A | ![]() |
1 | 1 | |||||||
MIRT588313 | Zyg11b | zyg-ll family member B, cell cycle regulator | ![]() |
1 | 2 | |||||||
MIRT588445 | Ybx1 | Y box protein 1 | ![]() |
1 | 2 | |||||||
MIRT591825 | Mapkap1 | mitogen-activated protein kinase associated protein 1 | ![]() |
1 | 2 | |||||||
MIRT592956 | Zdhhc3 | zinc finger, DHHC domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT593007 | Axl | AXL receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT593463 | Mylip | myosin regulatory light chain interacting protein | ![]() |
1 | 2 | |||||||
MIRT593797 | Mettl2 | methyltransferase like 2 | ![]() |
1 | 1 | |||||||
MIRT594568 | 2900026A02Rik | RIKEN cDNA 2900026A02 gene | ![]() |
1 | 1 | |||||||
MIRT595594 | Ago1 | argonaute RISC catalytic subunit 1 | ![]() |
1 | 1 | |||||||
MIRT597699 | Ppp1r2 | protein phosphatase 1, regulatory (inhibitor) subunit 2 | ![]() |
1 | 1 | |||||||
MIRT599114 | Ecd | ecdysoneless homolog (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT601960 | Nav1 | neuron navigator 1 | ![]() |
1 | 1 | |||||||
MIRT602350 | Fktn | fukutin | ![]() |
1 | 1 | |||||||
MIRT605621 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | ![]() |
1 | 1 | |||||||
MIRT606005 | Fam129a | family with sequence similarity 129, member A | ![]() |
1 | 1 | |||||||
MIRT606581 | Zfp941 | zinc finger protein 941 | ![]() |
1 | 1 | |||||||
MIRT756230 | HSF4 | heat shock transcription factor 4 | 2 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|