>Churc1|NM_206534|3'UTR
   1 GCCTCCCATGGTTCTCTTGTAACTGTGTTGGCTTGCTTTAAAATAGAGCAAGCCTAGGGCTGGTGAGATGGCTCAGTGGG
  81 TAAGAGCACCCGACTGCTCTTCCGAAGGTCCAAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACA
 161 AGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAA
 241 AATAGCAAGCCTAATGGTTTGTTTAGTAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uaCUAACGGUGUAAGACCUCAu 5' || | || | ||||||||| Target 5' ctGACTCCCTC-TTCTGGAGTg 3'	165 - 185	163.00	-16.90
2	miRNA 3' uacuaaCGGUGUAAGACCUCau 5' ||| : |||| | Target 5' gagcaaGCCTAGGGCTGGTGag 3'	46 - 67	92.00	-9.70
3	miRNA 3' uaCUAACG-GUGU---AAGACCUcau 5' |:| || |||| |||| | Target 5' atGGTGGCTCACAACCATCTGTAaca 3'	135 - 160	88.00	-9.13

- Nature structural & molecular biology, 2011

MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.