miRTarBase - #MIRT600723


—
pre-miRNA Information
pre-miRNA mmu-mir-10b   
Genomic Coordinates chr2: 74726070 - 74726137
Synonyms Mirn10b, mir-10b, mmu-mir-10b, Mir10b
Description Mus musculus miR-10b stem-loop
Comment The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-10b-5p
Sequence 5| UACCCUGUAGAACCGAAUUUGUG |27
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Kif24   
Synonyms 4933425J19Rik, 9430029L23Rik
Description kinesin family member 24
Transcript NM_024241   
Expression
Putative miRNA Targets on Kif24
3'UTR of Kif24
(miRNA target sites are highlighted)		 
>Kif24|NM_024241|3'UTR
   1 AGCATGTCTCACTCTGGATGGACACTGCTGTGCTCTCTGGGGCTGGAAGAGGCTCTGCCAGGGCCTTCCTAAAAACGACC
  81 CCTCCCTGTCCTGCCCCTAGGGTCAACCTAGCCATACATGGCCTTGGATGACCCACTACTCAGGGACAGACCTCATCTCA
 161 ACTCCCAACTACAGGGCCACCTGTAACAAAGTACTAGGCTGAAAGCCTTCATGTCCCCTTTTATTTGGGGCTCAGAGTAG
 241 TAGTCACTTTGCCAACCTGCATCTGTAGGGACTTGGTCTATTAACTTTGTAGATGTCCTAAATTTGAGGATAAGACTAGG
 321 ATGTTTAATGTTAACTTGGACATCGGAGGTCAGAGGTTAGGGAGCACAAGTTGAGCCAACAGCCTTATTGCTGACAGTGC
 401 CTTTCTGTCTTCAAAGACACTGGTACCAGCCAGGCAGTCAGGTGAACTCCTTCCCAGCAGGGAGTGGAAATTTAGTTTTG
 481 GAAATTATAAAATGAACAACTCTTTTTTTGTTTTGGTTTGGTTGTTTTTGTTTTGGTTTGGTTTTGGTTTTTCGAGACAG
 561 GGTTTCTCTGTATATCCCTGGCTGGCCTGGAACTCACTTTGTGGACCAGGCTGGCCTGGAACTCAGAAATCCACCTGCCT
 641 CTGCCTCCCAAGTGCTGGGATTAAAGGCGTGAGCCACCACACCTGGCGAACAACTCTTGATATCTTTCTTAAGAGCACCT
 721 GAGGTCCAGGGTATGCTTTTAGTTTCCTTCCCTGCAATCCAGCTTTGAGGGTGCCAACAGCAGCACGGTTTTCTCATTAA
 801 TTTTTCTTTTTTGCTAAAACAGCAGGCCCATGTCAGTGTCTGCCAGCCCTCATAGTTCTTGTGGCAGGTCCTAGCTCCTG
 881 TCTATGACTCCTCATTCCCAGTGCCTCTGAATGATTAAACAGGCTGGGAGATCTCAGGCAAGTCTATTGCCAAGGCTTGA
 961 GTGGTCCAAGGTACTAGGCCAGCAACACTCAAGGGCCTTTGCTACGGGTGTCTTGGGACTGAGTCTACAGTCAGCAGTCT
1041 GAATCTTCTGACACAGCAACAAACACACATCTCTTCAAATGAGTTCTTGCTGTATTGCTGTGTGTGCAGGACAGATGTTA
1121 CCAGGTACCCTCAAATCATTCTCTACCTTATTTTTGAAGCAAGTGTCTCCCTGTTGATCTACCCAGACTGATTAGCCAAC
1201 AAGTCCAAAATTCTTGTCTCTCCCTTCCCTTCTCAGACCACCGCTCCAGGCTTTCTTTTGAGACAGTGCCTCTCTATGCA
1281 GTCCTGGAGTTCTCTATGTAGACCAGCTCACAAAGTAGTCCTGCCTCACAAATGCCAAGATTAAAGATGTAGCATACACC
1361 ATTAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guguuuAAGCCAAGA-----UGUCCCAu 5'
                ||:||||:|     ||||||| 
Target 5' tttggtTTTGGTTTTTCGAGACAGGGTt 3'
 537 - 564 161.00 -17.10
2 
miRNA  3' guguUUAAGCCAAGAUGUCCCau 5'
              || ||    ||||||||  
Target 5' tctcAACTCCCAACTACAGGGcc 3'
 156 - 178 135.00 -13.60
3 
miRNA  3' guGUUUAAGCCAAGAUGUCCCAu 5'
            ::|||  | ||  ||||| | 
Target 5' tcTGAAT--GATTAAACAGGCTg 3'
 906 - 926 121.00 -6.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
231 mmu-miR-10b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004722 Hoxd10 homeobox D10 3 2
MIRT006017 Klf4 Kruppel-like factor 4 (gut) 1 1
MIRT006023 Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 1 1
MIRT577430 Tube1 epsilon-tubulin 1 1 1
MIRT577599 Suv39h2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT577747 Shroom1 shroom family member 1 1 2
MIRT578003 Pgpep1 pyroglutamyl-peptidase I 1 1
MIRT578625 Hapln4 hyaluronan and proteoglycan link protein 4 1 1
MIRT579103 Cmklr1 chemokine-like receptor 1 1 4
MIRT579662 Lyrm9 LYR motif containing 9 1 1
MIRT579868 Zbtb8b zinc finger and BTB domain containing 8b 1 1
MIRT580500 Tfam transcription factor A, mitochondrial 1 2
MIRT580586 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 1 2
MIRT581319 Rhbdl3 rhomboid, veinlet-like 3 (Drosophila) 1 5
MIRT581708 Ppara peroxisome proliferator activated receptor alpha 1 1
MIRT582366 Mtf1 metal response element binding transcription factor 1 1 1
MIRT582483 Mdga2 MAM domain containing glycosylphosphatidylinositol anchor 2 1 1
MIRT582499 Mboat1 membrane bound O-acyltransferase domain containing 1 1 1
MIRT582768 Kif3a kinesin family member 3A 1 1
MIRT582993 Iffo2 intermediate filament family orphan 2 1 1
MIRT583065 Hook3 hook microtubule tethering protein 3 1 1
MIRT584125 Crkl v-crk avian sarcoma virus CT10 oncogene homolog-like 1 1
MIRT584351 Cdk8 cyclin-dependent kinase 8 1 1
MIRT585185 Zfp780b zinc finger protein 780B 1 1
MIRT585254 Zfp446 zinc finger protein 446 1 2
MIRT585367 Xrcc2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 2
MIRT585505 Tstd2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 1 1
MIRT585618 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT585804 Smad9 SMAD family member 9 1 2
MIRT585818 Slc6a20b solute carrier family 6 (neurotransmitter transporter), member 20B 1 1
MIRT585860 Slc24a6 solute carrier family 8 (sodium/lithium/calcium exchanger), member B1 1 2
MIRT586086 Rfxank regulatory factor X-associated ankyrin-containing protein 1 2
MIRT586332 Pex13 peroxisomal biogenesis factor 13 1 2
MIRT586368 Pde4c phosphodiesterase 4C, cAMP specific 1 2
MIRT586442 Nsl1 NSL1, MIS12 kinetochore complex component 1 1
MIRT586459 Nosip nitric oxide synthase interacting protein 1 1
MIRT586481 Nkiras1 NFKB inhibitor interacting Ras-like protein 1 1 3
MIRT586572 Mrpl35 mitochondrial ribosomal protein L35 1 1
MIRT586609 Mmachc methylmalonic aciduria cblC type, with homocystinuria 1 1
MIRT587165 Gal3st3 galactose-3-O-sulfotransferase 3 1 1
MIRT587189 Foxl1 forkhead box L1 1 2
MIRT587283 Fadd Fas (TNFRSF6)-associated via death domain 1 1
MIRT587373 E130311K13Rik RIKEN cDNA E130311K13 gene 1 2
MIRT587418 Dnase2a deoxyribonuclease II alpha 1 2
MIRT587454 Dhx37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 2
MIRT587563 Cts8 cathepsin 8 1 1
MIRT587673 Cdk7 cyclin-dependent kinase 7 1 2
MIRT587797 Ccl9 chemokine (C-C motif) ligand 9 1 2
MIRT587875 Bpnt1 bisphosphate 3'-nucleotidase 1 1 1
MIRT587920 B4galnt2 beta-1,4-N-acetyl-galactosaminyl transferase 2 1 2
MIRT588215 Timmdc1 translocase of inner mitochondrial membrane domain containing 1 1 2
MIRT588253 Smco1 single-pass membrane protein with coiled-coil domains 1 1 2
MIRT588421 Zbtb6 zinc finger and BTB domain containing 6 1 2
MIRT588467 Xkrx X-linked Kx blood group related, X-linked 1 2
MIRT588529 Usp45 ubiquitin specific petidase 45 1 2
MIRT588787 Stam signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT589498 Mzt1 mitotic spindle organizing protein 1 1 1
MIRT589543 Mkl2 MKL/myocardin-like 2 1 1
MIRT589625 Lrrc58 leucine rich repeat containing 58 1 2
MIRT589675 Lats1 large tumor suppressor 1 2
MIRT589749 Ajuba ajuba LIM protein 1 2
MIRT589919 Gmeb1 glucocorticoid modulatory element binding protein 1 1 2
MIRT590375 Cep97 centrosomal protein 97 1 2
MIRT590421 Ccdc127 coiled-coil domain containing 127 1 2
MIRT590648 Arhgap19 Rho GTPase activating protein 19 1 1
MIRT590710 AI597468 transmembrane protein 263 1 2
MIRT590886 Ttyh1 tweety family member 1 1 2
MIRT591083 Polr1b polymerase (RNA) I polypeptide B 1 1
MIRT591534 9330159F19Rik RIKEN cDNA 9330159F19 gene 1 2
MIRT591587 Zbtb44 zinc finger and BTB domain containing 44 1 1
MIRT591693 Sc5d sterol-C5-desaturase 1 1
MIRT591757 Ppm1k protein phosphatase 1K (PP2C domain containing) 1 1
MIRT592097 Slc25a42 solute carrier family 25, member 42 1 1
MIRT592137 Rad1 RAD1 checkpoint DNA exonuclease 1 2
MIRT592197 March2 membrane-associated ring finger (C3HC4) 2 1 2
MIRT592617 Mga MAX gene associated 1 2
MIRT592760 Dusp3 dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 1 2
MIRT592803 Cbln3 cerebellin 3 precursor protein 1 2
MIRT592822 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 1 2
MIRT593171 D14Abb1e family with sequence similarity 208, member A 1 2
MIRT593283 C5ar2 complement component 5a receptor 2 1 2
MIRT593472 Il1rl1 interleukin 1 receptor-like 1 1 2
MIRT593491 Gjc3 gap junction protein, gamma 3 1 1
MIRT593498 Fam65b RHO family interacting cell polarization regulator 2 1 2
MIRT593526 Cflar CASP8 and FADD-like apoptosis regulator 1 2
MIRT593534 Cd93 CD93 antigen 1 1
MIRT593569 Fnip2 folliculin interacting protein 2 1 2
MIRT594284 Prf1 perforin 1 (pore forming protein) 1 1
MIRT596573 Zfp799 zinc finger protein 799 1 1
MIRT596640 Zfp354a zinc finger protein 354A 1 1
MIRT596652 Zfp345 zinc finger protein 345 1 1
MIRT596673 Zfp317 zinc finger protein 317 1 1
MIRT596681 Zfp113 zinc finger protein 113 1 1
MIRT596709 Zbtb8a zinc finger and BTB domain containing 8a 1 1
MIRT596856 Ttc26 tetratricopeptide repeat domain 26 1 1
MIRT596868 Ttc23 tetratricopeptide repeat domain 23 1 1
MIRT596916 Trim27 tripartite motif-containing 27 1 1
MIRT596931 Tox4 TOX high mobility group box family member 4 1 1
MIRT597009 Tigd3 tigger transposable element derived 3 1 1
MIRT597048 Tex9 testis expressed gene 9 1 1
MIRT597107 Syt15 synaptotagmin XV 1 1
MIRT597197 Sox7 SRY (sex determining region Y)-box 7 1 1
MIRT597250 Slc35e1 solute carrier family 35, member E1 1 1
MIRT597308 Slc15a1 solute carrier family 15 (oligopeptide transporter), member 1 1 1
MIRT597476 Trmt10a tRNA methyltransferase 10A 1 1
MIRT597488 Rbm8a RNA binding motif protein 8a 1 1
MIRT597509 Rbm11 RNA binding motif protein 11 1 1
MIRT597527 Rbak RB-associated KRAB zinc finger 1 1
MIRT597550 Ranbp3l RAN binding protein 3-like 1 1
MIRT597564 Rab11fip5 RAB11 family interacting protein 5 (class I) 1 1
MIRT597574 Pycr1 pyrroline-5-carboxylate reductase 1 1 1
MIRT597593 Ptpn2 protein tyrosine phosphatase, non-receptor type 2 1 1
MIRT597609 Ptk6 PTK6 protein tyrosine kinase 6 1 1
MIRT597766 Pnpla3 patatin-like phospholipase domain containing 3 1 1
MIRT597789 Plek pleckstrin 1 1
MIRT597907 Paxip1 PAX interacting (with transcription-activation domain) protein 1 1 1
MIRT597913 Parp11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT597941 Osbpl8 oxysterol binding protein-like 8 1 1
MIRT597957 Ooep oocyte expressed protein 1 1
MIRT598053 Nip7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT598119 Ncan neurocan 1 1
MIRT598263 Mfap1a microfibrillar-associated protein 1A 1 1
MIRT598332 Mbd4 methyl-CpG binding domain protein 4 1 1
MIRT598373 Man2a2 mannosidase 2, alpha 2 1 1
MIRT598418 Lrrn4cl LRRN4 C-terminal like 1 1
MIRT598491 Kdelc2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT598519 Klhl41 kelch-like 41 1 1
MIRT598693 Mroh1 maestro heat-like repeat family member 1 1 1
MIRT598757 Gpr68 G protein-coupled receptor 68 1 1
MIRT598783 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT598818 Gm4925 predicted gene 4925 1 1
MIRT599049 Exosc4 exosome component 4 1 1
MIRT599083 Efr3b EFR3 homolog B 1 1
MIRT599090 Efcab4a calcium release activated channel regulator 2B 1 1
MIRT599108 Ecm2 extracellular matrix protein 2, female organ and adipocyte specific 1 1
MIRT599222 Dclre1c DNA cross-link repair 1C 1 1
MIRT599442 Cercam cerebral endothelial cell adhesion molecule 1 1
MIRT599531 Car8 carbonic anhydrase 8 1 1
MIRT599607 Bloc1s3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT599699 Aqp7 aquaporin 7 1 1
MIRT599865 Aco1 aconitase 1 1 1
MIRT599882 Acer1 alkaline ceramidase 1 1 1
MIRT599940 Rmi2 RecQ mediated genome instability 2 1 1
MIRT599978 Tpgs2 tubulin polyglutamylase complex subunit 2 1 1
MIRT600025 2810006K23Rik RIKEN cDNA 2810006K23 gene 1 1
MIRT600078 Knop1 lysine rich nucleolar protein 1 1 1
MIRT600157 Zdhhc3 zinc finger, DHHC domain containing 3 1 1
MIRT600349 Ston2 stonin 2 1 1
MIRT600394 Slc2a4 solute carrier family 2 (facilitated glucose transporter), member 4 1 1
MIRT600423 Samd8 sterile alpha motif domain containing 8 1 1
MIRT600658 Mcc mutated in colorectal cancers 1 1
MIRT600702 Lpp LIM domain containing preferred translocation partner in lipoma 1 1
MIRT600723 Kif24 kinesin family member 24 1 1
MIRT600761 Isg20l2 interferon stimulated exonuclease gene 20-like 2 1 1
MIRT600996 Cybrd1 cytochrome b reductase 1 1 1
MIRT601015 Csrnp3 cysteine-serine-rich nuclear protein 3 1 1
MIRT601098 Cbfa2t2 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) 1 1
MIRT601226 Adra2b adrenergic receptor, alpha 2b 1 1
MIRT601591 Smtnl2 smoothelin-like 2 1 1
MIRT601646 Siglece sialic acid binding Ig-like lectin E 1 1
MIRT601665 Senp5 SUMO/sentrin specific peptidase 5 1 1
MIRT601782 Rac2 RAS-related C3 botulinum substrate 2 1 1
MIRT602037 Mmp25 matrix metallopeptidase 25 1 1
MIRT602292 Gls glutaminase 1 1
MIRT602338 Gaa glucosidase, alpha, acid 1 1
MIRT602474 Dnajc1 DnaJ heat shock protein family (Hsp40) member C1 1 1
MIRT602514 Decr2 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal 1 1
MIRT602527 Gdpgp1 GDP-D-glucose phosphorylase 1 1 1
MIRT602539 Cyb5d2 cytochrome b5 domain containing 2 1 1
MIRT602663 Car9 carbonic anhydrase 9 1 1
MIRT602819 Akap8 A kinase (PRKA) anchor protein 8 1 1
MIRT602835 Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT602888 4930519G04Rik RIKEN cDNA 4930519G04 gene 1 1
MIRT602982 Sgms2 sphingomyelin synthase 2 1 1
MIRT603255 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT603297 Spib Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT603481 Rbm34 RNA binding motif protein 34 1 1
MIRT603512 Rab11b RAB11B, member RAS oncogene family 1 1
MIRT603547 Ptchd2 dispatched RND transporter family member 3 1 1
MIRT603554 Psmb11 proteasome (prosome, macropain) subunit, beta type, 11 1 1
MIRT603570 Prdx1 peroxiredoxin 1 1 1
MIRT603657 Oscp1 organic solute carrier partner 1 1 1
MIRT603676 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT603763 Med18 mediator complex subunit 18 1 1
MIRT603767 Mdc1 mediator of DNA damage checkpoint 1 1 1
MIRT603839 Kcnk6 potassium inwardly-rectifying channel, subfamily K, member 6 1 1
MIRT603892 Ifnar1 interferon (alpha and beta) receptor 1 1 1
MIRT603926 Hist1h2ac histone cluster 1, H2ac 1 1
MIRT604032 Fam118a family with sequence similarity 118, member A 1 1
MIRT604060 Epb4.2 erythrocyte membrane protein band 4.2 1 1
MIRT604090 Dqx1 DEAQ RNA-dependent ATPase 1 1
MIRT604118 Dhrs7b dehydrogenase/reductase (SDR family) member 7B 1 1
MIRT604133 Ddhd2 DDHD domain containing 2 1 1
MIRT604150 Dars2 aspartyl-tRNA synthetase 2 (mitochondrial) 1 1
MIRT604256 Cenpl centromere protein L 1 1
MIRT604454 Fam227a family with sequence similarity 227, member A 1 1
MIRT604512 2010315B03Rik RIKEN cDNA 2010315B03 gene 1 1
MIRT604528 Zyg11b zyg-ll family member B, cell cycle regulator 1 1
MIRT604554 Vsig10 V-set and immunoglobulin domain containing 10 1 1
MIRT604566 Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT604664 Slc35e2 solute carrier family 35, member E2 1 1
MIRT604740 Rnd1 Rho family GTPase 1 1 1
MIRT604807 P2ry4 pyrimidinergic receptor P2Y, G-protein coupled, 4 1 1
MIRT604914 Irak2 interleukin-1 receptor-associated kinase 2 1 1
MIRT604951 Gng2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT605258 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT605263 2810474O19Rik RIKEN cDNA 2810474O19 gene 1 1
MIRT605269 Fam219b family with sequence similarity 219, member B 1 1
MIRT605372 Vamp3 vesicle-associated membrane protein 3 1 1
MIRT605384 Ube2j2 ubiquitin-conjugating enzyme E2J 2 1 1
MIRT605436 Stom stomatin 1 1
MIRT605576 Ocln occludin 1 1
MIRT605635 Mfn1 mitofusin 1 1 1
MIRT605641 Mcm5 minichromosome maintenance complex component 5 1 1
MIRT605969 Pafah1b2 platelet-activating factor acetylhydrolase, isoform 1b, subunit 2 1 1
MIRT606097 Utp15 UTP15 small subunit processome component 1 1
MIRT606147 Tcf25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT606229 Ramp1 receptor (calcitonin) activity modifying protein 1 1 1
MIRT606248 Ppih peptidyl prolyl isomerase H 1 1
MIRT606295 Nrcam neuronal cell adhesion molecule 1 1
MIRT606330 Mfsd11 major facilitator superfamily domain containing 11 1 1
MIRT606361 Iws1 IWS1, SUPT6 interacting protein 1 1
MIRT606415 Gfpt1 glutamine fructose-6-phosphate transaminase 1 1 1
MIRT606448 Eno2 enolase 2, gamma neuronal 1 1
MIRT606455 Elmo2 engulfment and cell motility 2 1 1
MIRT606575 Zmat3 zinc finger matrin type 3 1 1
MIRT606590 Wipf2 WAS/WASL interacting protein family, member 2 1 1
MIRT606638 Nufip2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT606677 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 1 1
MIRT606684 Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b 1 1
MIRT732919 MSN moesin 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10b (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-10b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10b Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10b Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10b Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-10b Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 up-regulated
miR-10b Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 up-regulated
miR-10b 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-10b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10b Formaldehyde NULL 712 Quantitative real-time PCR Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10b Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10b Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-10b 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-10b 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-10b Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-10b Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-10b Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated

Error report submission