| miRNA Infomation | |
|---|---|
| miRNA name | mmu-miR-1186b |
| Gene Information | |
|---|---|
| Gene Symbol | Dkc1 |
| Synonyms | BC068171 |
| Description | dyskeratosis congenita 1, dyskerin |
| Transcript | NM_001030307 |
| Expression | |
| Putative miRNA Targets on Dkc1 | |
| 3'UTR of Dkc1 (miRNA target sites are highlighted) |
>Dkc1|NM_001030307|3'UTR 1 TTTAAGCCACTTCTGGAAGCATTATGTCCAGCTGGGAAGAAAAAGAAAAGCCTTATTGGAAAAACTTTTTGTTGAGGGAG 81 AACAGAGGTCCCAGAGTAGAAAGTTCTGGTATACTTTTAGCTGCCACTTGTGACCTCAGTGGTTAGCTGGTGTGGCCATC 161 TCATCCCATCCTGTCCTGTTTTAAGGATATGAGAGATAAAATCAGGCCTTTGCCACCAACCCCTCTGCTTGCTTGAGGAA 241 GCCACACCTTTAGACATGGCATGGCCTAGTAACTATCTGCAGCTATTTACTAATGAGCATTTTCAACAATGCCATAGATA 321 GTCCTCTCCTACTTTGCTTTTTAAAAAGTTGGTAAAAATTAAATCTGCTACATAAAATGGTATAGAACCTTCTGTGAGAG 401 AAAAAATGTAATTGAACTATGTTCACTGGGGGACTCTTATCTCCAGTGTTCTATGAGGACTGCTCTATTCAGGTATTAAC 481 CTTGCCTGGTGGTATCTATGATATTTAGGCTAGTACTCTGTATTTTTGTGTACAACAGGATTTCTCTATATGGCTACTTG 561 TGTTTCTTATGGAAGCCAAAGCATTCCTGTACCTTCCTATTTGTTTTCTTTTAAAGAATGGAATTGCCGGGCGTGGTGGC 641 GCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAAGCCAGCCTGGTCTACAGAGTGAG 721 TTCCAGGACAGTCCAGGCTATACAGAGAAACCCTGTCTCGAAAAAAAAAAAACCAAAAAAACAAAAAACAAAACAAAAAA 801 ACCAAAAAACAAAAAAAACAAAAAAAAAAACAAAAAAACAAAAAAAGAAAAAAAAAAGAATGGAATTGTTCAGAATGGAA 881 TTGTTCATTGCTGAAGAATGTAATTTGTAGTTTTTTTTTTTTTAAAAAGTATTCCTGTTAGATTTACTATGATAATCTTG 961 GACTGGCAACAAAAGTGAGAGAATATTTTTATTAAAAGTCTGAGGTTTATGTCCT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | mESCs |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
| Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
| CLIP-seq Support 1 for dataset GSM4751758 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 3 |
| Location of target site | NM_001030307 | 3UTR | GCAUGCCUUUAAUCCCAGCACUUGGGAGGCAGAGGCAGGUGGAUUUCUGAGUUCAAAGCCAGCCUGGUCUACAGAGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4751762 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of eWAT 3 |
| Location of target site | NM_001030307 | 3UTR | CAUGCCUUUAAUCCCAGCACUUGGGAGGCAGAGGCAGGUGGAUUUCUGAGUUCAAAGCCAGCCUGGUCUACA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4751763 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of eWAT 4 |
| Location of target site | NM_001030307 | 3UTR | CCAGCACUUGGGAGGCAGAGGCAGGUGGAUUUCUGAGUUCAAAGCCAGCCUGGUCUACAGAGUGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM622573 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | mESCs / KO1 |
| Location of target site | NM_001030307 | 3UTR | AUGCCUUUAAUCCCAGCACUUGGGAGGCAGAGGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21258322 / GSE25310 |
| CLIP-seq Viewer | Link |
86 mmu-miR-1186b Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT576999 | Mark2 | MAP/microtubule affinity regulating kinase 2 |  |
|
2 | 2 | ||||||
| MIRT585120 | Zfp935 | zinc finger protein 935 | |
|
2 | 2 | ||||||
| MIRT586283 | Prc1 | protein regulator of cytokinesis 1 | |
|
2 | 4 | ||||||
| MIRT586381 | Pbld1 | phenazine biosynthesis-like protein domain containing 1 | |
|
2 | 2 | ||||||
| MIRT586708 | Loxl2 | lysyl oxidase-like 2 | |
|
2 | 4 | ||||||
| MIRT587092 | Gla | galactosidase, alpha | |
|
2 | 4 | ||||||
| MIRT587538 | Cxcr2 | chemokine (C-X-C motif) receptor 2 | |
|
2 | 2 | ||||||
| MIRT589503 | Myo1e | myosin IE | |
|
2 | 4 | ||||||
| MIRT589590 | Magt1 | magnesium transporter 1 | |
|
2 | 2 | ||||||
| MIRT590954 | Stxbp2 | syntaxin binding protein 2 | |
|
2 | 2 | ||||||
| MIRT591055 | Rab11fip1 | RAB11 family interacting protein 1 (class I) | |
|
2 | 2 | ||||||
| MIRT591076 | Polr2l | polymerase (RNA) II (DNA directed) polypeptide L | |
|
2 | 2 | ||||||
| MIRT591337 | Gm10778 | predicted gene 10778 | |
|
2 | 2 | ||||||
| MIRT592001 | Wdr34 | WD repeat domain 34 | |
|
2 | 4 | ||||||
| MIRT592296 | Foxr1 | forkhead box R1 | |
|
2 | 4 | ||||||
| MIRT593950 | Cpne1 | copine I | |
|
2 | 2 | ||||||
| MIRT593956 | Cpm | carboxypeptidase M | |
|
2 | 2 | ||||||
| MIRT595194 | Tmtc3 | transmembrane and tetratricopeptide repeat containing 3 | |
|
2 | 2 | ||||||
| MIRT595287 | Mef2c | myocyte enhancer factor 2C | |
|
2 | 2 | ||||||
| MIRT596506 | Zfp933 | zinc finger protein 933 | |
|
2 | 2 | ||||||
| MIRT596786 | Ubxn2a | UBX domain protein 2A | |
|
2 | 2 | ||||||
| MIRT597061 | Tcea1 | transcription elongation factor A (SII) 1 | |
|
2 | 2 | ||||||
| MIRT597101 | Taf1a | TATA-box binding protein associated factor, RNA polymerase I, A | |
|
2 | 2 | ||||||
| MIRT597153 | Stxbp4 | syntaxin binding protein 4 | |
|
2 | 2 | ||||||
| MIRT597459 | Rhag | Rhesus blood group-associated A glycoprotein | |
|
2 | 2 | ||||||
| MIRT597814 | Pla2g2d | phospholipase A2, group IID | |
|
2 | 2 | ||||||
| MIRT597836 | Pik3c2a | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha | |
|
2 | 2 | ||||||
| MIRT598087 | Nek7 | NIMA (never in mitosis gene a)-related expressed kinase 7 | |
|
2 | 2 | ||||||
| MIRT598275 | Med16 | mediator complex subunit 16 | |
|
2 | 2 | ||||||
| MIRT598705 | Haus2 | HAUS augmin-like complex, subunit 2 | |
|
2 | 2 | ||||||
| MIRT598887 | Glrx2 | glutaredoxin 2 (thioltransferase) | |
|
2 | 2 | ||||||
| MIRT598959 | Gemin8 | gem nuclear organelle associated protein 8 | |
|
2 | 2 | ||||||
| MIRT599390 | Clmn | calmin | |
|
2 | 2 | ||||||
| MIRT599417 | Chek2 | checkpoint kinase 2 | |
|
2 | 2 | ||||||
| MIRT599571 | Btc | betacellulin, epidermal growth factor family member | |
|
2 | 2 | ||||||
| MIRT599852 | Adarb1 | adenosine deaminase, RNA-specific, B1 | |
|
2 | 2 | ||||||
| MIRT599903 | Acat1 | acetyl-Coenzyme A acetyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT599922 | A830018L16Rik | RIKEN cDNA A830018L16 gene | |
|
2 | 2 | ||||||
| MIRT599998 | 4930579G24Rik | RIKEN cDNA 4930579G24 gene | |
|
2 | 2 | ||||||
| MIRT600123 | Zfyve27 | zinc finger, FYVE domain containing 27 | |
|
2 | 2 | ||||||
| MIRT600437 | Samd8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT600468 | Rbm4 | RNA binding motif protein 4 | |
|
2 | 2 | ||||||
| MIRT600872 | Gabpb2 | GA repeat binding protein, beta 2 | |
|
2 | 2 | ||||||
| MIRT601116 | Bri3bp | Bri3 binding protein | |
|
2 | 2 | ||||||
| MIRT601328 | Zfp689 | zinc finger protein 689 | |
|
2 | 2 | ||||||
| MIRT601448 | Tprkb | Tp53rk binding protein | |
|
2 | 2 | ||||||
| MIRT601451 | Tns4 | tensin 4 | |
|
2 | 2 | ||||||
| MIRT601483 | Tmod1 | tropomodulin 1 | |
|
2 | 2 | ||||||
| MIRT601536 | Tet1 | tet methylcytosine dioxygenase 1 | |
|
2 | 2 | ||||||
| MIRT601857 | Pkd2 | polycystic kidney disease 2 | |
|
2 | 2 | ||||||
| MIRT601946 | Nwd1 | NACHT and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT602015 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | |
|
2 | 2 | ||||||
| MIRT602020 | Moap1 | modulator of apoptosis 1 | |
|
2 | 2 | ||||||
| MIRT602190 | Hyal1 | hyaluronoglucosaminidase 1 | |
|
2 | 2 | ||||||
| MIRT602217 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT602370 | Fbxl3 | F-box and leucine-rich repeat protein 3 | |
|
2 | 2 | ||||||
| MIRT602416 | F2r | coagulation factor II (thrombin) receptor | |
|
2 | 2 | ||||||
| MIRT602429 | Ercc4 | excision repair cross-complementing rodent repair deficiency, complementation group 4 | |
|
2 | 2 | ||||||
| MIRT602495 | Dkc1 | dyskeratosis congenita 1, dyskerin | |
|
2 | 2 | ||||||
| MIRT602566 | Csf2rb | colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) | |
|
2 | 2 | ||||||
| MIRT602668 | Car5b | carbonic anhydrase 5b, mitochondrial | |
|
2 | 2 | ||||||
| MIRT602688 | Camk4 | calcium/calmodulin-dependent protein kinase IV | |
|
2 | 2 | ||||||
| MIRT602852 | Abcd2 | ATP-binding cassette, sub-family D (ALD), member 2 | |
|
2 | 2 | ||||||
| MIRT602997 | Pdzd2 | PDZ domain containing 2 | |
|
2 | 2 | ||||||
| MIRT603145 | Ubxn8 | UBX domain protein 8 | |
|
2 | 2 | ||||||
| MIRT603436 | Rpl7l1 | ribosomal protein L7-like 1 | |
|
2 | 2 | ||||||
| MIRT603456 | Rhbdl2 | rhomboid, veinlet-like 2 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT603635 | Pbxip1 | pre B cell leukemia transcription factor interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT603725 | Mrpl51 | mitochondrial ribosomal protein L51 | |
|
2 | 2 | ||||||
| MIRT603750 | Mfsd2b | major facilitator superfamily domain containing 2B | |
|
2 | 2 | ||||||
| MIRT603819 | Kif5b | kinesin family member 5B | |
|
2 | 2 | ||||||
| MIRT603907 | Hpgds | hematopoietic prostaglandin D synthase | |
|
2 | 2 | ||||||
| MIRT603918 | Hltf | helicase-like transcription factor | |
|
2 | 2 | ||||||
| MIRT603975 | Gnal | guanine nucleotide binding protein, alpha stimulating, olfactory type | |
|
2 | 2 | ||||||
| MIRT604114 | Diap2 | diaphanous related formin 2 | |
|
2 | 2 | ||||||
| MIRT604187 | Cxcl11 | chemokine (C-X-C motif) ligand 11 | |
|
2 | 2 | ||||||
| MIRT604294 | Ccdc36 | coiled-coil domain containing 36 | |
|
2 | 2 | ||||||
| MIRT604400 | Aida | axin interactor, dorsalization associated | |
|
2 | 2 | ||||||
| MIRT604629 | Syt11 | synaptotagmin XI | |
|
2 | 2 | ||||||
| MIRT604707 | Scml4 | sex comb on midleg-like 4 (Drosophila) | |
|
2 | 2 | ||||||
| MIRT604967 | Gga2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | |
|
2 | 2 | ||||||
| MIRT605165 | C030039L03Rik | zinc finger protein 607B | |
|
2 | 2 | ||||||
| MIRT605198 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | |
|
2 | 2 | ||||||
| MIRT605619 | Mpv17 | MpV17 mitochondrial inner membrane protein | |
|
2 | 2 | ||||||
| MIRT606468 | Tcaim | T cell activation inhibitor, mitochondrial | |
1 | 1 | |||||||
| MIRT606659 | Lsm11 | U7 snRNP-specific Sm-like protein LSM11 | |
|
2 | 2 | ||||||