miRTarBase - #MIRT602870


—
pre-miRNA Information
pre-miRNA mmu-mir-3961   
Genomic Coordinates chr13: 82698275 - 82698333
Description Mus musculus miR-3961 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-3961
Sequence 38| UGCCCUCAGCUCAGUUGGA |56
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Mcmdc2   
Synonyms 6030422M02Rik
Description minichromosome maintenance domain containing 2
Transcript NM_177722   
Expression
Putative miRNA Targets on Mcmdc2
3'UTR of Mcmdc2
(miRNA target sites are highlighted)		 
>Mcmdc2|NM_177722|3'UTR
   1 GCAATTTAAGAATTACCTTTCGGGCCTAGCAAACACAGAAGTGGATGTTCACAGTCAGCTATAGGATGGAACACAGGGCC
  81 CCCAATGGAGGAGCTAGAGAAAGTACCCAAGGAGCTGAAGGGGTCTGCAACCCTATAGGTGGAACAACAATATGAACTAA
 161 CCAGTACCCCCAGGAGCTCGTGTCTCTGGCTGCATATGTAGCAGAAGATGGCCTAGTTGGCCATCAGTGGAAAGAGAGGC
 241 CCATTGGTCTTGTAAACTTTATATGCCTCAGTACAGGGGAACGCCAGGGCCAAGAAGTGGGAGGGGGGAAGGGGGAGAGG
 321 GCATGGGGGACTTTTGGGATAGCTTTGGAAATGTAAATGAAGAAAGTACCTAATAAAAAAAAAGGAAAAATTACCTTTCA
 401 TGCCCCATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agguugacucgaCUCCCGu 5'
                      |||||| 
Target 5' ggggaagggggaGAGGGCa 3'
 305 - 323 120.00 -15.00
2 
miRNA  3' agGUUGACUCGACUCCCgu 5'
            |||  ||||||| ||  
Target 5' ccCAA-GGAGCTGAAGGgg 3'
 106 - 123 112.00 -19.70
3 
miRNA  3' agguugacucgacUCCCGu 5'
                       ||||| 
Target 5' taggatggaacacAGGGCc 3'
 62 - 80 100.00 -6.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agguugaCUCG-ACUCCCgu 5'
                 |:|| ||:|||  
Target 5' ------aGGGCAUGGGGGac 3'
 		1 - 14
Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
33 mmu-miR-3961 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT580374 Tmem206 transmembrane protein 206 2 4
MIRT588925 Sh3pxd2a SH3 and PX domains 2A 2 6
MIRT589433 Nid1 nidogen 1 2 2
MIRT592155 Paxip1 PAX interacting (with transcription-activation domain) protein 1 2 2
MIRT593445 Slc25a27 solute carrier family 25, member 27 2 4
MIRT596576 Zfp790 zinc finger protein 790 2 2
MIRT597139 Sumf2 sulfatase modifying factor 2 2 2
MIRT597636 Prrc1 proline-rich coiled-coil 1 2 2
MIRT598943 Ggps1 geranylgeranyl diphosphate synthase 1 2 2
MIRT600143 Zfp1 zinc finger protein 1 2 2
MIRT601504 Tmem88b transmembrane protein 88B 2 2
MIRT601517 Tmem151a transmembrane protein 151A 2 2
MIRT601642 Slc12a8 solute carrier family 12 (potassium/chloride transporters), member 8 2 2
MIRT601708 Rtkn2 rhotekin 2 2 2
MIRT601810 Prrxl1 paired related homeobox protein-like 1 2 2
MIRT601824 Prpf31 pre-mRNA processing factor 31 2 2
MIRT601873 Pigv phosphatidylinositol glycan anchor biosynthesis, class V 2 2
MIRT602604 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT602810 Akr1d1 aldo-keto reductase family 1, member D1 2 2
MIRT602829 AK010878 GON7, KEOPS complex subunit homolog 2 2
MIRT602860 Rmi2 RecQ mediated genome instability 2 1 1
MIRT602870 Mcmdc2 minichromosome maintenance domain containing 2 1 1
MIRT602959 Xpo7 exportin 7 2 2
MIRT603096 Zfp287 zinc finger protein 287 2 2
MIRT603386 Sgol2 shugoshin 2A 2 2
MIRT603717 N4bp2l2 NEDD4 binding protein 2-like 2 2 2
MIRT604022 Fam81a family with sequence similarity 81, member A 2 2
MIRT604137 Dclre1b DNA cross-link repair 1B 2 2
MIRT604673 Shisa6 shisa family member 6 2 2
MIRT604960 Gm5113 predicted gene 5113 2 2
MIRT606285 Nufip1 nuclear fragile X mental retardation protein interacting protein 1 2 2
MIRT606419 Fsd1l fibronectin type III and SPRY domain containing 1-like 2 2
MIRT606580 Zfp941 zinc finger protein 941 2 2

Error report submission