>Klk8|NM_008940|3'UTR
   1 TCCTGGTGTGTGTGTGTGGGGGGGGTTGTCAATAAACACCACCATTGGCTGGCTCCT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aacuaUCCUCCACGAGUUAUUu 5' :||:||| ||||||| Target 5' tgtggGGGGGGTTGTCAATAAa 3'	15 - 36	161.00	-17.10

- Nature structural & molecular biology, 2011

MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.