pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-669m-1 |
Genomic Coordinates | chr2: 10512790 - 10512887 |
Synonyms | mmu-mir-669m-1, Mir669m-1 |
Description | Mus musculus miR-669m-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | mmu-mir-669m-2 |
Genomic Coordinates | chr2: 10513434 - 10513531 |
Synonyms | mmu-mir-669m-2, Mir669m-2 |
Description | Mus musculus miR-669m-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-669m-5p |
Sequence | 25| UGUGUGCAUGUGCAUGUGUGUAU |47 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Trim65 | ||||||||||||||||||||
Synonyms | 4732463G12Rik | ||||||||||||||||||||
Description | tripartite motif-containing 65 | ||||||||||||||||||||
Transcript | NM_178802 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Trim65 | |||||||||||||||||||||
3'UTR of Trim65 (miRNA target sites are highlighted) |
>Trim65|NM_178802|3'UTR
1 GGAAGGCACAGACAGGTGCCACCGTGCCTGGGTGCCCAAAAGTGGCCCCACCTCTAGCTTCTAGAAGGAACAGCTGTTGG
81 CCTCTCTGTTGACTCAGAGACGGACATGGGAGAGGAGCCTTAGAACAAAGTTTACTTTTTACTATCTATGAAGGGGACAG
161 GGGACAGAGAGAAATTAAATAGGAAGTCCCAGCCCCAAGCAAGAACCAGGTTCTTAGCATTGCGTGGACATCTATCTTAG
241 TCACTGTTCTGTTGCTGTGAAGAGACACCATGACTAAGGCAACTCTATAGAAGAAAGCGTTTAACTCAGGGCTTGCTAAC
321 AGTTTTAGCCCATGATTATCATGGAGGGAAGCAGACAGGCGTGGTGCTAGAGCAGTAGTCAGGAGCTTCACATCCTGATC
401 ACCAGGCGCATGGGCACGAGTGCGCACGCACACACACACACACACACACACACACACTCACGCACACA GACTAGCATAGG
481 CTTTTGTATATTTAAAGTGACACACTCCCCCAACAAGGCCACACCTCCTAATCCCTCTCAAACAGTTCCACCAAGTGGGG
561 ACTAAGCGCACAGGCTGTAGACAGCCAATGTGGTGATGAGTATGGGTGCAGCAGATGTGGTGTGGCAGATGTGAACCGCT
641 TTCCTTTGCTTGTCCCACATATGCTTCCATGAAGGTTCTGGGTGGTTTTTTGCTCACATTTCTGGAAGTAGAATTTTTTT
721 TTTTTTTTTTTTTTTGTACTGGGTATAGAGTCTGAAATGTTTTGAATGCTAACATTCAGAGTTCTGATCTCTCACTGACA
801 ACATCTCCAGCCTGGGGTGATTTATTTACTTGAGAGCCCCCCACCTCCCCCCCCCCCCATGTTCTGATGTTGGTGGTAGT
881 TACAAGGAAGCCCACTTTTGTAATGTCCTTTTCTTTTTGTAATTCCTTAAGCATTTGTTTTGTATGCTCGTGGGTAAACA
961 TCTCACAAAAAAATTAGAAATTCTTTCATGTTTATTTAGTGTGGGACTCAGAGTGGGGTGGCTTGTGTACGCCATGGCTT
1041 ACGTGTGGAGGTCAGAGGACAACTTGCAGGAGTCCGATCTCTCCTTCTACCATGTGGGTTCTGGAGTGGAACCCAGACTG
1121 TCACGCTTGACAGCAAGCACATTGGGATAGCTGCAGTTATCCCATCATCCCGACAATAACAGGTTTTTGTTGTTTGAAAC
1201 ACGATATCTCTATGAACCCCTGGTTGGCTCAGAACTATGTAGACCAGGCTGTCCAACTCATAAAAATCTGAACCCCCATC
1281 AGTGGCCTCTAAGAGTTTTTAAAGAATTATATGTGCAATAATATATTCCCTAGGGAAGATATAAATATTTTATATGAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A
HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
CLIP-seq Support 1 for dataset GSM622570 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | mESCs / WT1A |
Location of target site | NM_178802 | 3UTR | UGCGCACGCACACACACACACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21258322 / GSE25310 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM622571 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | mESCs / WT1B |
Location of target site | NM_178802 | 3UTR | UGCGCACGCACACACACACACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21258322 / GSE25310 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM622572 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | mESCs / WT2 |
Location of target site | NM_178802 | 3UTR | UGCGCACGCACACACACACACACACACACACAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21258322 / GSE25310 |
CLIP-seq Viewer | Link |
87 mmu-miR-669m-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT577337 | Zfp157 | zinc finger protein 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577486 | Tns4 | tensin 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT578069 | Oxsm | 3-oxoacyl-ACP synthase, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT578341 | Ltf | lactotransferrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT578746 | Gm4841 | predicted gene 4841 | ![]() |
![]() |
2 | 4 | ||||||
MIRT578823 | Fermt1 | fermitin family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579125 | Chrnd | cholinergic receptor, nicotinic, delta polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT579138 | Chrna1 | cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) | ![]() |
![]() |
2 | 2 | ||||||
MIRT579308 | BC021785 | major facilitator superfamily domain containing 4B5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579418 | Agtrap | angiotensin II, type I receptor-associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT579730 | Zfp92 | zinc finger protein 92 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579980 | Wrn | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 4 | ||||||
MIRT581036 | Sim1 | single-minded homolog 1 (Drosophila) | ![]() |
![]() |
2 | 4 | ||||||
MIRT581534 | Pten | phosphatase and tensin homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT582315 | Nab1 | Ngfi-A binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT582845 | Itga9 | integrin alpha 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT582975 | Igf2 | insulin-like growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT583471 | Foxk1 | forkhead box K1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT584664 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585223 | Zfp488 | zinc finger protein 488 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585300 | Zfp26 | zinc finger protein 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585313 | Zfp248 | zinc finger protein 248 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585836 | Slc6a17 | solute carrier family 6 (neurotransmitter transporter), member 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT586076 | Rhobtb1 | Rho-related BTB domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586328 | Pgm5 | phosphoglucomutase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT587380 | Dzip3 | DAZ interacting protein 3, zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT587614 | Cml2 | N-acetyltransferase 8 (GCN5-related) family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587630 | Clec7a | C-type lectin domain family 7, member a | ![]() |
![]() |
2 | 8 | ||||||
MIRT587724 | Cd28 | CD28 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT587756 | Cd200r1 | CD200 receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588014 | Akap7 | A kinase (PRKA) anchor protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588297 | 1700019G17Rik | N-acetyltransferase 8 (GCN5-related) family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588558 | Uhrf1bp1l | UHRF1 (ICBP90) binding protein 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT588688 | Tet2 | tet methylcytosine dioxygenase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588895 | Slc1a2 | solute carrier family 1 (glial high affinity glutamate transporter), member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT589020 | Rnf11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589098 | Rasal2 | RAS protein activator like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT590108 | Etv3 | ets variant 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590173 | Elovl6 | ELOVL family member 6, elongation of long chain fatty acids (yeast) | ![]() |
![]() |
2 | 4 | ||||||
MIRT590925 | Tacr2 | tachykinin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591064 | Ptpre | protein tyrosine phosphatase, receptor type, E | ![]() |
![]() |
2 | 4 | ||||||
MIRT591145 | Nsun3 | NOL1/NOP2/Sun domain family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591206 | Mdm2 | transformed mouse 3T3 cell double minute 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591428 | Car10 | carbonic anhydrase 10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591504 | Acot2 | acyl-CoA thioesterase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591558 | Zfp449 | zinc finger protein 449 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591634 | Ubtf | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT591949 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591975 | Ap1ar | adaptor-related protein complex 1 associated regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT592039 | Tnfrsf13c | tumor necrosis factor receptor superfamily, member 13c | ![]() |
![]() |
2 | 2 | ||||||
MIRT592090 | Smo | smoothened, frizzled class receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592111 | Slc25a12 | solute carrier family 25 (mitochondrial carrier, Aralar), member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592172 | Oxtr | oxytocin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592215 | Map3k7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592225 | Magee2 | melanoma antigen, family E, 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT592248 | Lcp2 | lymphocyte cytosolic protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT592265 | Kcnj16 | potassium inwardly-rectifying channel, subfamily J, member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592389 | Trp53i11 | transformation related protein 53 inducible protein 11 | ![]() |
![]() |
2 | 6 | ||||||
MIRT592424 | Stxbp5l | syntaxin binding protein 5-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT592444 | Snx12 | sorting nexin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592518 | Npr3 | natriuretic peptide receptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592624 | Mbnl3 | muscleblind like splicing factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT592705 | Gfra2 | glial cell line derived neurotrophic factor family receptor alpha 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592745 | Epas1 | endothelial PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592762 | Dmd | dystrophin, muscular dystrophy | ![]() |
![]() |
2 | 4 | ||||||
MIRT592846 | Akap2 | A kinase (PRKA) anchor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592988 | Cacna2d2 | calcium channel, voltage-dependent, alpha 2/delta subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593001 | Bend4 | BEN domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593230 | Fndc3a | fibronectin type III domain containing 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT593419 | Neurod2 | neurogenic differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT593451 | Rab11fip1 | RAB11 family interacting protein 1 (class I) | ![]() |
![]() |
2 | 2 | ||||||
MIRT593485 | Havcr2 | hepatitis A virus cellular receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593515 | Csf2ra | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | ![]() |
![]() |
2 | 2 | ||||||
MIRT594036 | 2810006K23Rik | RIKEN cDNA 2810006K23 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT594128 | Fam104a | family with sequence similarity 104, member A | ![]() |
1 | 1 | |||||||
MIRT595669 | Rxrb | retinoid X receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT595702 | Fndc7 | fibronectin type III domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT596266 | Bnc2 | basonuclin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT596280 | Slc6a8 | solute carrier family 6 (neurotransmitter transporter, creatine), member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT598760 | Gpr68 | G protein-coupled receptor 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT601113 | Btrc | beta-transducin repeat containing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT601203 | Arhgef9 | CDC42 guanine nucleotide exchange factor (GEF) 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT603153 | Ubxn8 | UBX domain protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT603194 | Trim65 | tripartite motif-containing 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT604580 | Trim71 | tripartite motif-containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605450 | St18 | suppression of tumorigenicity 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605589 | Ncam1 | neural cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 |