pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-466h |
Genomic Coordinates | chr2: 10514891 - 10514971 |
Description | Mus musculus miR-466h stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-466h-5p |
Sequence | 11| UGUGUGCAUGUGCUUGUGUGUA |32 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Trim71 | ||||||||||||||||||||
Synonyms | 2610206G21Rik, AL022943, Gm1127, Lin41, lin-41, mLin41, mlin-41 | ||||||||||||||||||||
Description | tripartite motif-containing 71 | ||||||||||||||||||||
Transcript | NM_001042503 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Trim71 | |||||||||||||||||||||
3'UTR of Trim71 (miRNA target sites are highlighted) |
>Trim71|NM_001042503|3'UTR 1 TTGTGTCTTCTGGGGTTTTCTGTGTTTAGGGTGTGCATGTGTGTGTCTCTCATTTTTGAATTTCAAAGAAGAAATCGTCT 81 CAGGGATATTTCTTTTTCTTTTTCCCCCCCTTTATTTTTATTATTTTTTTTTTTTTAAGAACAAAAGTACAACATTGCCT 161 AAGTCCTACCTCAGCTTAAATTTTTTTTTTTTTTTTTTTTTTACAGATGAATGTAATTCTCCTCTGTGCAGGGCTTGAGC 241 CTGTGAAGTGATAATTTCTATCTACCTCAACTCTTTGCATTTCCCTCTCTGGCAAGCCTCTTGGCTCACATCCTCTTCCC 321 TCCTGAAGGCCTAGGAGGCACAGGACAGCGGTCCTGCAACCTTGAGGGCACTGGAAGCATATGGTGGGGTGCATGCATTT 401 TGTAGATTGAGCCAAGGAAACCCAAAAACTACTAAGTAAAAAAGAGAAGTATAAGATGTTGGAAAGATAGGATTTAAAAT 481 TCATAATTGTAGTGTATTTGTGTTCTTGAGAATACTGTGTTTATGTGGGGTTAGGTTGTGTGTGGTTTGCTCTTTTCTTT 561 TTTATCGATGCAACAGGGCTTTTCTCTGTTTACCTCAGTGTGTCTGACATCTCATCCCTAGGAGATATGGCTGTGGCTTG 641 CTAGCCTAGAAAAGCAGACCATTCATATTTTCGGGTGTCTCATCTTTGTATCTGGTAAAGAAGGGTGGGTGTGTGGGAGT 721 GTGTGTGTGCACACGCGTGCATGTTTGTGTTTCAAAGCCATCTTTGCTTGAGGAGAAAAGCTGGACTTGACACAAGACAT 801 CCCAAGCAAATTTCTTCCCAGTTTGCTAAGAAACTCGATTTAGCTCAGGACTCTAGGTTGAAAGTGTTCGCAAAGGTTAC 881 GTGTCTGTGTTTTTGTTGTTTGTTATAAAGACTTAGGTATAAGAAAATAAGTTAACCTTGTTCTCAGAGAGAGAGGGGCT 961 TTTCAGATGTGGACCAGGGTGCCACAGAAGTGGGGGGTGCTGGAGAAGTGAGGCACCCCCACATCAGGGACTGTTCAGGA 1041 GGGCGGGGGACCTCGTCTCTATGTGTGAGGGTGTGGTAGGCAAAGGGATAGCTTTGATTTGAGAAGCACAATGTTTTTTC 1121 CTGCTTTGGAAGTTCAGGGAATGTAGAAGATTGTCTGACTGGTGGGAGCACCTCACTCCCTAACCCTTGGCTCAGGTCTG 1201 TTTCTCAGGAACCTTCCCTAAGTCTGAGTGGAGGCAGACCTCAAGGTTAACACAAAGCCCCGTTCCTCCCCCAAAGGCCT 1281 TTGAATGTAAAGGATTTACAAACCAAACCACCCAACAGGAAGTGTAGGACACAGTATATGTCTTTTTTTTTTTTTAATTT 1361 TATTTTATTTAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | mESCs | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
CLIP-seq Support 1 for dataset GSM4751763 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | adipose tissue / RNA sequencing of eWAT 4 |
Location of target site | NM_001042503 | 3UTR | GGGAGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE142677 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM622572 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | mESCs / WT2 |
Location of target site | NM_001042503 | 3UTR | CUGGUAAAGAAGGGUGGGUGUGUGGGAGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21258322 / GSE25310 |
CLIP-seq Viewer | Link |
87 mmu-miR-466h-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT577339 | Zfp157 | zinc finger protein 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577488 | Tns4 | tensin 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT578067 | Oxsm | 3-oxoacyl-ACP synthase, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT578343 | Ltf | lactotransferrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT578743 | Gm4841 | predicted gene 4841 | ![]() |
![]() |
2 | 4 | ||||||
MIRT578822 | Fermt1 | fermitin family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579127 | Chrnd | cholinergic receptor, nicotinic, delta polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT579135 | Chrna1 | cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) | ![]() |
![]() |
2 | 2 | ||||||
MIRT579305 | BC021785 | major facilitator superfamily domain containing 4B5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579417 | Agtrap | angiotensin II, type I receptor-associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT579732 | Zfp92 | zinc finger protein 92 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579978 | Wrn | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 4 | ||||||
MIRT581035 | Sim1 | single-minded homolog 1 (Drosophila) | ![]() |
![]() |
2 | 4 | ||||||
MIRT581532 | Pten | phosphatase and tensin homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT582312 | Nab1 | Ngfi-A binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT582843 | Itga9 | integrin alpha 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT582976 | Igf2 | insulin-like growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT583470 | Foxk1 | forkhead box K1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT584662 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585220 | Zfp488 | zinc finger protein 488 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585299 | Zfp26 | zinc finger protein 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585311 | Zfp248 | zinc finger protein 248 | ![]() |
![]() |
2 | 4 | ||||||
MIRT585835 | Slc6a17 | solute carrier family 6 (neurotransmitter transporter), member 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT586077 | Rhobtb1 | Rho-related BTB domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586329 | Pgm5 | phosphoglucomutase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT587381 | Dzip3 | DAZ interacting protein 3, zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT587611 | Cml2 | N-acetyltransferase 8 (GCN5-related) family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587631 | Clec7a | C-type lectin domain family 7, member a | ![]() |
![]() |
2 | 8 | ||||||
MIRT587725 | Cd28 | CD28 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT587758 | Cd200r1 | CD200 receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588012 | Akap7 | A kinase (PRKA) anchor protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588296 | 1700019G17Rik | N-acetyltransferase 8 (GCN5-related) family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588555 | Uhrf1bp1l | UHRF1 (ICBP90) binding protein 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT588689 | Tet2 | tet methylcytosine dioxygenase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588893 | Slc1a2 | solute carrier family 1 (glial high affinity glutamate transporter), member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT589021 | Rnf11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589101 | Rasal2 | RAS protein activator like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT590106 | Etv3 | ets variant 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590170 | Elovl6 | ELOVL family member 6, elongation of long chain fatty acids (yeast) | ![]() |
![]() |
2 | 4 | ||||||
MIRT590929 | Tacr2 | tachykinin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591061 | Ptpre | protein tyrosine phosphatase, receptor type, E | ![]() |
![]() |
2 | 4 | ||||||
MIRT591144 | Nsun3 | NOL1/NOP2/Sun domain family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591210 | Mdm2 | transformed mouse 3T3 cell double minute 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591429 | Car10 | carbonic anhydrase 10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591502 | Acot2 | acyl-CoA thioesterase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT591557 | Zfp449 | zinc finger protein 449 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591632 | Ubtf | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT591952 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591973 | Ap1ar | adaptor-related protein complex 1 associated regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT592040 | Tnfrsf13c | tumor necrosis factor receptor superfamily, member 13c | ![]() |
![]() |
2 | 2 | ||||||
MIRT592091 | Smo | smoothened, frizzled class receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592109 | Slc25a12 | solute carrier family 25 (mitochondrial carrier, Aralar), member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592174 | Oxtr | oxytocin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT592217 | Map3k7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592224 | Magee2 | melanoma antigen, family E, 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT592250 | Lcp2 | lymphocyte cytosolic protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT592267 | Kcnj16 | potassium inwardly-rectifying channel, subfamily J, member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592390 | Trp53i11 | transformation related protein 53 inducible protein 11 | ![]() |
![]() |
2 | 6 | ||||||
MIRT592420 | Stxbp5l | syntaxin binding protein 5-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT592441 | Snx12 | sorting nexin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592515 | Npr3 | natriuretic peptide receptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592626 | Mbnl3 | muscleblind like splicing factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT592703 | Gfra2 | glial cell line derived neurotrophic factor family receptor alpha 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592746 | Epas1 | endothelial PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592765 | Dmd | dystrophin, muscular dystrophy | ![]() |
![]() |
2 | 4 | ||||||
MIRT592843 | Akap2 | A kinase (PRKA) anchor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592989 | Cacna2d2 | calcium channel, voltage-dependent, alpha 2/delta subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593003 | Bend4 | BEN domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593228 | Fndc3a | fibronectin type III domain containing 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT593415 | Neurod2 | neurogenic differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT593453 | Rab11fip1 | RAB11 family interacting protein 1 (class I) | ![]() |
![]() |
2 | 2 | ||||||
MIRT593482 | Havcr2 | hepatitis A virus cellular receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT593517 | Csf2ra | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | ![]() |
![]() |
2 | 2 | ||||||
MIRT594037 | 2810006K23Rik | RIKEN cDNA 2810006K23 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT594129 | Fam104a | family with sequence similarity 104, member A | ![]() |
1 | 1 | |||||||
MIRT595670 | Rxrb | retinoid X receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT595701 | Fndc7 | fibronectin type III domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT596268 | Bnc2 | basonuclin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT596281 | Slc6a8 | solute carrier family 6 (neurotransmitter transporter, creatine), member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT598763 | Gpr68 | G protein-coupled receptor 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT601111 | Btrc | beta-transducin repeat containing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT601202 | Arhgef9 | CDC42 guanine nucleotide exchange factor (GEF) 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT603151 | Ubxn8 | UBX domain protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT603192 | Trim65 | tripartite motif-containing 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT604581 | Trim71 | tripartite motif-containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605447 | St18 | suppression of tumorigenicity 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605591 | Ncam1 | neural cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 |