pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-3065 |
Genomic Coordinates | chr11: 120014767 - 120014853 |
Description | Mus musculus miR-3065 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-3065-5p |
Sequence | 14| UCAACAAAAUCACUGAUGCUGG |35 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Nudt11 | ||||||||||||||||||||
Synonyms | DIPP3, DIPP3b | ||||||||||||||||||||
Description | nudix (nucleoside diphosphate linked moiety X)-type motif 11 | ||||||||||||||||||||
Transcript | NM_021431 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Nudt11 | |||||||||||||||||||||
3'UTR of Nudt11 (miRNA target sites are highlighted) |
>Nudt11|NM_021431|3'UTR 1 TGAACCGAGGCATGCTCAAGATCACACTGAAATCATCATTGATGTGAACCCAGTATCCAGTGGTATTGTCAAGTTCACCG 81 GAGCACCATTAAGGTTGCCAAGGAGACCGCTCATTCTGGTTTTCCTTCTACATCTTGGAACACTCTTCTGTCTATCTTAC 161 CAACGTTTTTTGCTCTGGTTGTTGTACTATTGTGTGTGAACGGACTTAATTCAGCACCTATAGCCTTTCGTTGTGCTTTT 241 CTGATGTGTCTGCTTTCTTCATTACACCTTTGAGAGCAATGACTATTTTTCCTTACTCTGCATATTCTGCATCCAAGACA 321 CTACTTGAAATATGGTTGGCATCACTGGAGGTCTTTGATTCTATTAGTATTTTGTAATCTCTTTGTGGCTAAACATTTCC 401 CTCCCAATCTGGTGCTAGTAGAGTATCCGCTGTCTAAGCACCACGTGTGTAGCTCATGTGTATTCGGTGTTGCAGAAACA 481 TTTCAGGACAGTTTGAGATGTTCCAGAACAAGAATTAGTATTCATTTATATGTCATACCACACAATGGCTGGCATGGTTT 561 TAATATTATGTCATCATTTAGGGTAACATTTTATAGAATTAGTCCTTCACCTAACAACTTTAGTGTTTTTGTACTGTTGC 641 TAATTTGCTTAAAATTTTATTCAAAAGGTATCACTTGGTATAAAGGTAATTGTAACACATTACAATGAAAACCTATTGTG 721 AGTTTTTATAAAAAATAAATTTTAAATTAATATACAAAGAATAATACATTTAATTTTTTTTGCAGTGCTCTACTTCTGAA 801 ATGTCACCTTAACATTTCCTTGCAGAAAATTCTGGGGTTGTTTTTGTTGTTGTTGTTGTTGTTTACAGATTCAATATTCT 881 GTATTATTTGATGATGAGCACGAAAAAAAAAAAACCTGCTACTGAAGCAGTTTTCAGAGCTAATTGTGCCATTTAGTTGC 961 TTAAGTGTCTTTTGCCTCTCTCACTTTTTCAGTTGGCTGTGGTTCTCATCCCTTTCCTAGTACAGTGGTCTGGCTGGCTC 1041 CTCAGTACCACAAGCTCTCTGCATGTTTATGCAGAGGAGAGTGAGTGCTAAATTGGTGTCCCTTAGAAAGGCTTCAGGGA 1121 AAGAGACTGCTGTAAAGGGGAATGCAAAATAAAGAGTTTAAATGAGGAAGCTCAGTTTGACTCTTTCCAGAAGAATAACT 1201 TTATGCCAAGGACAAAGACATTTCAGAGTTTTGTCACAGGGTGTGTGATGTCAACACTCTTACTCAGCTCATCCTGAGGG 1281 TTCCAAAGAGGTTCTGATATGGCTGGTGGTTGTGTCTCGCTTTTTCATTATAAACCATTAGATTTGGAAAGGCCTGAACT 1361 CCAATTTAGTGTTAACACCCTTCCTCATGGTACCAGTGAAATGTATTGTGTCCCCATATCTTACAGACGTTAAAATAAAA 1441 CCACACATTCTAATTTGCTGGAGTTTCTATTTGTGACATGTACTATGTGGATGTGCTTTCTAAAGAAACCCTTATCTTTT 1521 AGAAAACTGTACTGAAAATTTACAGAGATGCTACTGTTATTTGCTTCAATATAATCAGGGTGGTATACGTTTGTACATAG 1601 ATGAAACAAGACTGACTCTGACTTGATAATTGTTGAAGCTGTGTGATAGATGTTTGAGAATTCATTATTCTCTATACTTT 1681 TGTATATGTTTGAAATTTTCCATAATAAAAATTGTAAAACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | mESCs | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
133 mmu-miR-3065-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT430695 | Atp2b2 | ATPase, Ca++ transporting, plasma membrane 2 | ![]() |
1 | 1 | |||||||
MIRT577276 | Zfp619 | zinc finger protein 619 | ![]() |
1 | 1 | |||||||
MIRT577437 | Ttyh1 | tweety family member 1 | ![]() |
1 | 1 | |||||||
MIRT577647 | Sod2 | superoxide dismutase 2, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT577852 | Rassf9 | Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 | ![]() |
1 | 1 | |||||||
MIRT577896 | Prrg4 | proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) | ![]() |
1 | 4 | |||||||
MIRT577952 | Pole4 | polymerase (DNA-directed), epsilon 4 (p12 subunit) | ![]() |
1 | 1 | |||||||
MIRT578007 | Pgpep1 | pyroglutamyl-peptidase I | ![]() |
1 | 1 | |||||||
MIRT578136 | Noc3l | NOC3 like DNA replication regulator | ![]() |
1 | 1 | |||||||
MIRT578205 | Naaa | N-acylethanolamine acid amidase | ![]() |
1 | 3 | |||||||
MIRT578451 | Ints7 | integrator complex subunit 7 | ![]() |
1 | 2 | |||||||
MIRT578772 | Gatsl2 | GATS protein-like 2 | ![]() |
1 | 2 | |||||||
MIRT578776 | Gata1 | GATA binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT578863 | Fam163a | family with sequence similarity 163, member A | ![]() |
1 | 1 | |||||||
MIRT578864 | Fam159b | family with sequence similarity 159, member B | ![]() |
1 | 1 | |||||||
MIRT579037 | Cts8 | cathepsin 8 | ![]() |
1 | 1 | |||||||
MIRT579539 | Coa5 | cytochrome C oxidase assembly factor 5 | ![]() |
1 | 1 | |||||||
MIRT579653 | 2010106E10Rik | RIKEN cDNA 2010106E10 gene | ![]() |
1 | 1 | |||||||
MIRT579710 | Zic1 | zinc finger protein of the cerebellum 1 | ![]() |
1 | 1 | |||||||
MIRT579721 | Zfp92 | zinc finger protein 92 | ![]() |
1 | 2 | |||||||
MIRT579828 | Zfp106 | zinc finger protein 106 | ![]() |
1 | 1 | |||||||
MIRT579873 | Zbtb8b | zinc finger and BTB domain containing 8b | ![]() |
1 | 1 | |||||||
MIRT579938 | Zbtb34 | zinc finger and BTB domain containing 34 | ![]() |
1 | 1 | |||||||
MIRT580092 | Usp54 | ubiquitin specific peptidase 54 | ![]() |
1 | 1 | |||||||
MIRT580347 | Tmem33 | transmembrane protein 33 | ![]() |
1 | 1 | |||||||
MIRT580373 | Tmem229a | transmembrane protein 229A | ![]() |
1 | 2 | |||||||
MIRT580541 | Tcp11l2 | t-complex 11 (mouse) like 2 | ![]() |
1 | 1 | |||||||
MIRT580657 | Stxbp5l | syntaxin binding protein 5-like | ![]() |
1 | 2 | |||||||
MIRT580728 | Srrm4 | serine/arginine repetitive matrix 4 | ![]() |
1 | 1 | |||||||
MIRT580766 | Spp1 | secreted phosphoprotein 1 | ![]() |
1 | 1 | |||||||
MIRT580853 | Slc8a1 | solute carrier family 8 (sodium/calcium exchanger), member 1 | ![]() |
1 | 1 | |||||||
MIRT581257 | Rras2 | related RAS viral (r-ras) oncogene 2 | ![]() |
1 | 1 | |||||||
MIRT581367 | Rcor3 | REST corepressor 3 | ![]() |
1 | 1 | |||||||
MIRT581452 | Ranbp3l | RAN binding protein 3-like | ![]() |
1 | 1 | |||||||
MIRT581626 | Prkar2a | protein kinase, cAMP dependent regulatory, type II alpha | ![]() |
1 | 1 | |||||||
MIRT581835 | Pkia | protein kinase inhibitor, alpha | ![]() |
1 | 1 | |||||||
MIRT581897 | Phc3 | polyhomeotic-like 3 (Drosophila) | ![]() |
1 | 2 | |||||||
MIRT582138 | Npr3 | natriuretic peptide receptor 3 | ![]() |
1 | 1 | |||||||
MIRT582434 | Mllt3 | myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 | ![]() |
1 | 1 | |||||||
MIRT582435 | Kmt2a | lysine (K)-specific methyltransferase 2A | ![]() |
1 | 1 | |||||||
MIRT582473 | Med28 | mediator complex subunit 28 | ![]() |
1 | 1 | |||||||
MIRT582523 | March1 | membrane-associated ring finger (C3HC4) 1 | ![]() |
1 | 2 | |||||||
MIRT582739 | Kpna1 | karyopherin (importin) alpha 1 | ![]() |
1 | 1 | |||||||
MIRT582765 | Klf12 | Kruppel-like factor 12 | ![]() |
1 | 1 | |||||||
MIRT583052 | Hoxc4 | homeobox C4 | ![]() |
1 | 1 | |||||||
MIRT583070 | Hnrnpul2 | heterogeneous nuclear ribonucleoprotein U-like 2 | ![]() |
1 | 1 | |||||||
MIRT583389 | Fzd6 | frizzled class receptor 6 | ![]() |
1 | 1 | |||||||
MIRT583418 | Fubp3 | far upstream element (FUSE) binding protein 3 | ![]() |
1 | 2 | |||||||
MIRT583486 | Foxc2 | forkhead box C2 | ![]() |
1 | 1 | |||||||
MIRT583748 | Ephb2 | Eph receptor B2 | ![]() |
1 | 1 | |||||||
MIRT583894 | Dtna | dystrobrevin alpha | ![]() |
1 | 1 | |||||||
MIRT583996 | Dck | deoxycytidine kinase | ![]() |
1 | 1 | |||||||
MIRT584018 | Dcaf17 | DDB1 and CUL4 associated factor 17 | ![]() |
1 | 1 | |||||||
MIRT584023 | Tmem245 | transmembrane protein 245 | ![]() |
1 | 2 | |||||||
MIRT584102 | Csnk1e | casein kinase 1, epsilon | ![]() |
1 | 1 | |||||||
MIRT584246 | Cnnm3 | cyclin M3 | ![]() |
1 | 2 | |||||||
MIRT584385 | Cdh12 | cadherin 12 | ![]() |
1 | 1 | |||||||
MIRT584396 | Cdc37l1 | cell division cycle 37-like 1 | ![]() |
1 | 1 | |||||||
MIRT584462 | Cbfa2t3 | core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) | ![]() |
1 | 1 | |||||||
MIRT584494 | Camkk2 | calcium/calmodulin-dependent protein kinase kinase 2, beta | ![]() |
1 | 1 | |||||||
MIRT584630 | Bbx | bobby sox HMG box containing | ![]() |
1 | 1 | |||||||
MIRT584793 | Arl5a | ADP-ribosylation factor-like 5A | ![]() |
1 | 1 | |||||||
MIRT584821 | Arid3b | AT rich interactive domain 3B (BRIGHT-like) | ![]() |
1 | 1 | |||||||
MIRT584838 | Arhgef18 | rho/rac guanine nucleotide exchange factor (GEF) 18 | ![]() |
1 | 1 | |||||||
MIRT584952 | Adamts5 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) | ![]() |
1 | 1 | |||||||
MIRT585099 | Zfp945 | zinc finger protein 945 | ![]() |
1 | 1 | |||||||
MIRT585623 | Tnfaip6 | tumor necrosis factor alpha induced protein 6 | ![]() |
1 | 1 | |||||||
MIRT585661 | Tmco1 | transmembrane and coiled-coil domains 1 | ![]() |
1 | 2 | |||||||
MIRT585936 | Slc14a2 | solute carrier family 14 (urea transporter), member 2 | ![]() |
1 | 2 | |||||||
MIRT586062 | Rnd1 | Rho family GTPase 1 | ![]() |
1 | 1 | |||||||
MIRT586696 | Lrrtm4 | leucine rich repeat transmembrane neuronal 4 | ![]() |
1 | 1 | |||||||
MIRT586756 | Kdm5d | lysine (K)-specific demethylase 5D | ![]() |
1 | 1 | |||||||
MIRT586958 | Grhl1 | grainyhead-like 1 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT586989 | Gpr107 | G protein-coupled receptor 107 | ![]() |
1 | 1 | |||||||
MIRT586997 | Gpkow | G patch domain and KOW motifs | ![]() |
1 | 1 | |||||||
MIRT587056 | Gm5464 | predicted gene 5464 | ![]() |
1 | 1 | |||||||
MIRT587297 | Extl1 | exostoses (multiple)-like 1 | ![]() |
1 | 1 | |||||||
MIRT587428 | Dmd | dystrophin, muscular dystrophy | ![]() |
1 | 1 | |||||||
MIRT587531 | Cxxc5 | CXXC finger 5 | ![]() |
1 | 1 | |||||||
MIRT587941 | Atp1b3 | ATPase, Na+/K+ transporting, beta 3 polypeptide | ![]() |
1 | 1 | |||||||
MIRT588042 | Aim2 | absent in melanoma 2 | ![]() |
1 | 1 | |||||||
MIRT588860 | Smad7 | SMAD family member 7 | ![]() |
1 | 1 | |||||||
MIRT588862 | Slit3 | slit homolog 3 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT588901 | Slc16a6 | solute carrier family 16 (monocarboxylic acid transporters), member 6 | ![]() |
1 | 1 | |||||||
MIRT588916 | Skor1 | SKI family transcriptional corepressor 1 | ![]() |
1 | 1 | |||||||
MIRT588918 | Six6 | sine oculis-related homeobox 6 | ![]() |
1 | 1 | |||||||
MIRT588969 | Sall1 | sal-like 1 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT588972 | S1pr3 | sphingosine-1-phosphate receptor 3 | ![]() |
1 | 2 | |||||||
MIRT589007 | Robo1 | roundabout guidance receptor 1 | ![]() |
1 | 1 | |||||||
MIRT589016 | Rnf150 | ring finger protein 150 | ![]() |
1 | 2 | |||||||
MIRT589317 | Pbx1 | pre B cell leukemia homeobox 1 | ![]() |
1 | 2 | |||||||
MIRT589465 | Ncam1 | neural cell adhesion molecule 1 | ![]() |
1 | 2 | |||||||
MIRT589658 | Lhfpl4 | lipoma HMGIC fusion partner-like protein 4 | ![]() |
1 | 1 | |||||||
MIRT589751 | Jph1 | junctophilin 1 | ![]() |
1 | 1 | |||||||
MIRT589804 | Id1 | inhibitor of DNA binding 1 | ![]() |
1 | 1 | |||||||
MIRT590017 | Foxa1 | forkhead box A1 | ![]() |
1 | 1 | |||||||
MIRT590127 | Ercc6 | excision repair cross-complementing rodent repair deficiency, complementation group 6 | ![]() |
1 | 1 | |||||||
MIRT590256 | Dennd5b | DENN/MADD domain containing 5B | ![]() |
1 | 1 | |||||||
MIRT590273 | Dcun1d1 | DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT590384 | Cep170 | centrosomal protein 170 | ![]() |
1 | 1 | |||||||
MIRT590678 | Ankrd28 | ankyrin repeat domain 28 | ![]() |
1 | 1 | |||||||
MIRT590712 | Agtr1b | angiotensin II receptor, type 1b | ![]() |
1 | 1 | |||||||
MIRT590770 | Faxc | failed axon connections homolog | ![]() |
1 | 1 | |||||||
MIRT593316 | Nudcd3 | NudC domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT593331 | Ddx3x | DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked | ![]() |
1 | 1 | |||||||
MIRT594854 | Ncapg2 | non-SMC condensin II complex, subunit G2 | ![]() |
1 | 1 | |||||||
MIRT595054 | Ankrd29 | ankyrin repeat domain 29 | ![]() |
1 | 1 | |||||||
MIRT597158 | Ston1 | stonin 1 | ![]() |
1 | 1 | |||||||
MIRT598524 | Itsn1 | intersectin 1 (SH3 domain protein 1A) | ![]() |
1 | 1 | |||||||
MIRT598732 | Gucy2c | guanylate cyclase 2c | ![]() |
1 | 1 | |||||||
MIRT599943 | Rmi2 | RecQ mediated genome instability 2 | ![]() |
1 | 1 | |||||||
MIRT600798 | Hmg20a | high mobility group 20A | ![]() |
1 | 1 | |||||||
MIRT600906 | Fam126b | family with sequence similarity 126, member B | ![]() |
1 | 1 | |||||||
MIRT603234 | Tlr3 | toll-like receptor 3 | ![]() |
1 | 1 | |||||||
MIRT603378 | Sh2d4a | SH2 domain containing 4A | ![]() |
1 | 1 | |||||||
MIRT604113 | Dis3l | DIS3 like exosome 3'-5' exoribonuclease | ![]() |
1 | 1 | |||||||
MIRT604271 | Cd33 | CD33 antigen | ![]() |
1 | 1 | |||||||
MIRT604719 | Samd8 | sterile alpha motif domain containing 8 | ![]() |
1 | 1 | |||||||
MIRT604725 | Rs1 | retinoschisis (X-linked, juvenile) 1 (human) | ![]() |
1 | 1 | |||||||
MIRT604981 | Ftsj1 | FtsJ RNA methyltransferase homolog 1 (E. coli) | ![]() |
1 | 1 | |||||||
MIRT604997 | Fgf13 | fibroblast growth factor 13 | ![]() |
1 | 1 | |||||||
MIRT605729 | Gm5415 | predicted gene 5415 | ![]() |
1 | 1 | |||||||
MIRT605798 | Creb3l2 | cAMP responsive element binding protein 3-like 2 | ![]() |
1 | 1 | |||||||
MIRT605930 | Sertad3 | SERTA domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT605934 | Senp8 | SUMO/sentrin specific peptidase 8 | ![]() |
1 | 1 | |||||||
MIRT606120 | Trerf1 | transcriptional regulating factor 1 | ![]() |
1 | 1 | |||||||
MIRT606209 | Sdad1 | SDA1 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT606288 | Nudt11 | nudix (nucleoside diphosphate linked moiety X)-type motif 11 | ![]() |
1 | 1 | |||||||
MIRT606324 | Ms4a6b | membrane-spanning 4-domains, subfamily A, member 6B | ![]() |
1 | 1 | |||||||
MIRT606376 | Igf1 | insulin-like growth factor 1 | ![]() |
1 | 1 | |||||||
MIRT606464 | Deptor | DEP domain containing MTOR-interacting protein | ![]() |
1 | 1 | |||||||
MIRT606642 | Nhsl2 | NHS-like 2 | ![]() |
1 | 1 | |||||||
MIRT606667 | Kcnh1 | potassium voltage-gated channel, subfamily H (eag-related), member 1 | ![]() |
1 | 1 |