pre-miRNA Information
pre-miRNA hsa-mir-4446   
Genomic Coordinates chr3: 113594876 - 113594942
Description Homo sapiens miR-4446 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4446-5p
Sequence 8| AUUUCCCUGCCAUUCCCUUGGC |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1356015605 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IL1RAPL1   
Synonyms IL-1-RAPL-1, IL-1RAPL-1, IL1R8, IL1RAPL, IL1RAPL-1, MRX10, MRX21, MRX34, OPHN4, TIGIRR-2
Description interleukin 1 receptor accessory protein like 1
Transcript NM_014271   
Expression
Putative miRNA Targets on IL1RAPL1
3'UTR of IL1RAPL1
(miRNA target sites are highlighted)
>IL1RAPL1|NM_014271|3'UTR
   1 CAGAAAAGCAAGGGACATCCCGTCCCTGGGAGGTTGAGTGGAATCTGCAGTCCAGTGCCTGGAACTAAATCCTCGACTGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cgguuccCUUACCG-UCCCUUUa 5'
                 |||  || ||||| | 
Target 5' -----caGAAAAGCAAGGGACAt 3'
1 - 18 119.00 -8.67
2
miRNA  3' cgguuCCCU-UACCGUCCCUUUa 5'
               |||| :| | || |:|| 
Target 5' tccctGGGAGGTTG-AGTGGAAt 3'
23 - 44 104.00 -15.40
3
miRNA  3' cgguucccuuaccgucCCUUUA 5'
                          |||| |
Target 5' ctgcagtccagtgcctGGAACT 3'
45 - 66 68.00 -9.10
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1310025323 7 dbSNP
rs1475579994 9 dbSNP
rs1162709559 18 dbSNP
rs1239726288 19 dbSNP
rs766017219 23 dbSNP
rs751033164 29 dbSNP
rs369147232 32 dbSNP
rs781046009 34 dbSNP
rs1381778386 35 dbSNP
rs752671784 37 dbSNP
rs1330871009 44 dbSNP
rs371562657 49 dbSNP
rs1436204035 51 dbSNP
rs992914318 55 dbSNP
rs1220593930 56 dbSNP
rs1157474359 68 dbSNP
rs1024361427 71 dbSNP
rs1270984686 75 dbSNP
rs989577494 76 dbSNP
rs1465983819 88 dbSNP
rs1477584633 88 dbSNP
rs970600008 88 dbSNP
rs980990240 89 dbSNP
rs1195798851 94 dbSNP
rs1488548844 98 dbSNP
rs189952046 112 dbSNP
rs1474172979 116 dbSNP
rs1216033249 119 dbSNP
rs1183066883 121 dbSNP
rs941929882 138 dbSNP
rs1310070725 140 dbSNP
rs775345744 141 dbSNP
rs973078440 144 dbSNP
rs1281725876 146 dbSNP
rs1415200366 153 dbSNP
rs1341730153 164 dbSNP
rs918923068 166 dbSNP
rs772031005 174 dbSNP
rs1423696276 180 dbSNP
rs1163143343 182 dbSNP
rs1176344638 190 dbSNP
rs749020770 192 dbSNP
rs1422826725 193 dbSNP
rs1458092272 216 dbSNP
rs1478009554 220 dbSNP
rs761258776 223 dbSNP
rs928936589 231 dbSNP
rs1051517849 232 dbSNP
rs911605123 237 dbSNP
rs1311776480 252 dbSNP
rs943203407 252 dbSNP
rs1450341059 261 dbSNP
rs1261471523 266 dbSNP
rs1038857051 267 dbSNP
rs1319021489 280 dbSNP
rs1278137787 281 dbSNP
rs1051470630 286 dbSNP
rs1380754946 291 dbSNP
rs1284811434 292 dbSNP
rs1302872628 292 dbSNP
rs1446628238 292 dbSNP
rs1379830338 300 dbSNP
rs1227612632 301 dbSNP
rs1291215355 304 dbSNP
rs1331031976 305 dbSNP
rs1332943988 309 dbSNP
rs1465996406 312 dbSNP
rs773170703 318 dbSNP
rs1168445842 326 dbSNP
rs1209108006 327 dbSNP
rs911615978 341 dbSNP
rs943570935 342 dbSNP
rs1182567341 348 dbSNP
rs899105294 350 dbSNP
rs1241597045 358 dbSNP
rs994746336 358 dbSNP
rs1458498469 359 dbSNP
rs1257780448 362 dbSNP
rs532865583 376 dbSNP
rs747908685 380 dbSNP
rs904806470 381 dbSNP
rs1211648238 383 dbSNP
rs1000851039 396 dbSNP
rs1053324977 402 dbSNP
rs774520556 405 dbSNP
rs891808745 418 dbSNP
rs770914406 419 dbSNP
rs1186515180 420 dbSNP
rs1414824425 421 dbSNP
rs1014234675 429 dbSNP
rs762047654 431 dbSNP
rs1296189611 432 dbSNP
rs1473152956 442 dbSNP
rs1350439017 446 dbSNP
rs970528894 459 dbSNP
rs1002072726 462 dbSNP
rs1163976613 463 dbSNP
rs1423334834 465 dbSNP
rs1383389820 472 dbSNP
rs1180780353 479 dbSNP
rs1440505506 480 dbSNP
rs1021242381 484 dbSNP
rs1194483067 486 dbSNP
rs1489670456 499 dbSNP
rs1266602690 500 dbSNP
rs1221398668 501 dbSNP
rs1251364575 504 dbSNP
rs202241036 504 dbSNP
rs1287485226 505 dbSNP
rs1240451739 506 dbSNP
rs1160588303 509 dbSNP
rs1304372704 509 dbSNP
rs1363815704 509 dbSNP
rs1375755076 509 dbSNP
rs1420354381 509 dbSNP
rs765911053 509 dbSNP
rs879066952 509 dbSNP
rs867412129 510 dbSNP
rs1334938543 511 dbSNP
rs1435288026 513 dbSNP
rs1025015394 528 dbSNP
rs1191151795 529 dbSNP
rs1489987722 532 dbSNP
rs970761216 533 dbSNP
rs1445906944 535 dbSNP
rs1311052373 539 dbSNP
rs1258646867 545 dbSNP
rs1352229605 548 dbSNP
rs1312590408 559 dbSNP
rs1300276026 564 dbSNP
rs1402852944 568 dbSNP
rs1342339362 582 dbSNP
rs12854875 590 dbSNP
rs1228813409 597 dbSNP
rs1298731904 601 dbSNP
rs1287434782 609 dbSNP
rs1033923154 627 dbSNP
rs12855790 628 dbSNP
rs12855205 629 dbSNP
rs973298533 638 dbSNP
rs1400755035 639 dbSNP
rs919143959 640 dbSNP
rs12857717 641 dbSNP
rs12854891 642 dbSNP
rs1002357589 647 dbSNP
rs1467734402 648 dbSNP
rs775366175 652 dbSNP
rs987076288 656 dbSNP
rs1220529488 657 dbSNP
rs1195016436 658 dbSNP
rs1487679570 659 dbSNP
rs1259010235 660 dbSNP
rs1201846152 663 dbSNP
rs1483401407 665 dbSNP
rs1278891214 668 dbSNP
rs966971088 668 dbSNP
rs911672818 676 dbSNP
rs1208075718 680 dbSNP
rs1319723061 701 dbSNP
rs1278784404 724 dbSNP
rs943103282 725 dbSNP
rs1254647109 749 dbSNP
rs1217862009 752 dbSNP
rs1325958824 761 dbSNP
rs1033792602 762 dbSNP
rs1397832678 789 dbSNP
rs1403230542 795 dbSNP
rs1336316348 799 dbSNP
rs763151512 808 dbSNP
rs1039241680 809 dbSNP
rs1181931618 814 dbSNP
rs12855630 830 dbSNP
rs1172055894 834 dbSNP
rs1238038285 834 dbSNP
rs1475346117 835 dbSNP
rs1231473289 839 dbSNP
rs1479129338 844 dbSNP
rs1189070383 845 dbSNP
rs1173443893 847 dbSNP
rs1242213888 847 dbSNP
rs1201327423 848 dbSNP
rs1424709488 853 dbSNP
rs926115999 857 dbSNP
rs1170524977 861 dbSNP
rs1372356429 863 dbSNP
rs6630978 869 dbSNP
rs1247167974 873 dbSNP
rs1341125538 873 dbSNP
rs1327944286 876 dbSNP
rs1402938290 879 dbSNP
rs1450673936 879 dbSNP
rs1333837959 882 dbSNP
rs866509320 887 dbSNP
rs1395053176 888 dbSNP
rs1181399252 892 dbSNP
rs1384011213 892 dbSNP
rs1423367895 892 dbSNP
rs1472850036 892 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgguucccuuaccgUCCCUUUa 5'
                        :|||||| 
Target 5' ------------cgGGGGAAAa 3'
1 - 10
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BCBL-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA ...

- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgguucccuuaccgUCCCUUUa 5'
                        :|||||| 
Target 5' ------------cgGGGGAAAa 3'
1 - 10
Article - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al.
- PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MCF7 , MDA-MB-231
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395163. RNA binding protein: AGO. Condition:MCF7 AGO HITS-CLIP Replicate 1 HITS-CLIP data was present in GSM1395171. RNA binding protein: AGO. Condition:MDA-MB-231 AGO HITS-CLIP Replicate 3 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1015448
Method / RBP HITS-CLIP / AGO2
Cell line / Condition BCBL-1 / BCBL-1 mRNA
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22927820 / GSE41357
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000378993.1 | 3UTR | UCGGGGGAAAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000378993.1 | 3UTR | GGGGGAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000378993.1 | 3UTR | GGGGGAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000378993.1 | 3UTR | GGGGGAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1395163
Method / RBP HITS-CLIP / AGO
Cell line / Condition MCF7 / MCF7 AGO HITS-CLIP Replicate 1
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1395171
Method / RBP HITS-CLIP / AGO
Cell line / Condition MDA-MB-231 / MDA-MB-231 AGO HITS-CLIP Replicate 3
Location of target site ENST00000378993.1 | 3UTR | CGGGGGAAAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
223 hsa-miR-4446-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT078060 PCTP phosphatidylcholine transfer protein 2 2
MIRT099072 FOXC1 forkhead box C1 2 2
MIRT130186 TXNIP thioredoxin interacting protein 2 2
MIRT148786 NARS asparaginyl-tRNA synthetase 2 2
MIRT261965 SEPHS1 selenophosphate synthetase 1 2 2
MIRT345867 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT409087 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT451883 SOD2 superoxide dismutase 2 2 4
MIRT469236 RHOB ras homolog family member B 2 2
MIRT469435 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT483055 FOXB1 forkhead box B1 2 8
MIRT484640 TBC1D5 TBC1 domain family member 5 2 6
MIRT493106 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 6
MIRT497307 TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 2 2
MIRT497798 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT501273 SCARB2 scavenger receptor class B member 2 2 4
MIRT506756 KMT2D lysine methyltransferase 2D 2 2
MIRT511986 EEF2 eukaryotic translation elongation factor 2 2 4
MIRT513126 ZNF431 zinc finger protein 431 2 2
MIRT519733 ZNF394 zinc finger protein 394 2 4
MIRT520351 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT520542 TPPP tubulin polymerization promoting protein 2 8
MIRT530782 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 2
MIRT531112 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT532144 GALNT8 polypeptide N-acetylgalactosaminyltransferase 8 2 2
MIRT533208 WAPAL WAPL cohesin release factor 2 2
MIRT533419 TWF1 twinfilin actin binding protein 1 2 2
MIRT534063 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT534288 SLAIN2 SLAIN motif family member 2 2 2
MIRT537796 EFNB2 ephrin B2 2 2
MIRT538017 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT538058 DMD dystrophin 2 2
MIRT538132 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT538680 CCDC80 coiled-coil domain containing 80 2 2
MIRT538788 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT542762 PPAP2B phospholipid phosphatase 3 2 2
MIRT546861 RAB10 RAB10, member RAS oncogene family 2 4
MIRT547418 MED4 mediator complex subunit 4 2 4
MIRT551633 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT552329 ZNF704 zinc finger protein 704 2 2
MIRT556124 MFSD9 major facilitator superfamily domain containing 9 2 4
MIRT559290 ATXN1 ataxin 1 2 2
MIRT562125 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT563777 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 2 2
MIRT564430 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT566102 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT567126 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT571213 RRS1 ribosome biogenesis regulator homolog 2 2
MIRT571939 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT571967 KIF21A kinesin family member 21A 2 2
MIRT606792 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 8
MIRT607351 TNS1 tensin 1 2 4
MIRT609416 GJB7 gap junction protein beta 7 2 4
MIRT609522 AZI2 5-azacytidine induced 2 2 4
MIRT611218 FAM174B family with sequence similarity 174 member B 2 2
MIRT611385 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT612053 KLB klotho beta 2 4
MIRT612102 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT612146 SIX1 SIX homeobox 1 2 4
MIRT612488 SIX3 SIX homeobox 3 2 4
MIRT613685 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613763 TTC38 tetratricopeptide repeat domain 38 2 2
MIRT613876 FGD1 FYVE, RhoGEF and PH domain containing 1 2 2
MIRT613965 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 4
MIRT614894 PAPOLG poly(A) polymerase gamma 2 2
MIRT614912 NFIA nuclear factor I A 2 2
MIRT615013 ERGIC2 ERGIC and golgi 2 2 2
MIRT615106 BCL7A BCL tumor suppressor 7A 2 2
MIRT615242 FAM227A family with sequence similarity 227 member A 2 4
MIRT615695 NEGR1 neuronal growth regulator 1 2 2
MIRT615956 ERBB3 erb-b2 receptor tyrosine kinase 3 2 4
MIRT615979 FSTL4 follistatin like 4 2 2
MIRT616053 PTPRE protein tyrosine phosphatase, receptor type E 2 4
MIRT616073 TBX2 T-box 2 2 4
MIRT616234 NPAS3 neuronal PAS domain protein 3 2 2
MIRT616306 CELF2 CUGBP Elav-like family member 2 2 2
MIRT616474 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT616662 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT616887 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT616902 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT617025 SYT6 synaptotagmin 6 2 2
MIRT617162 SLC16A5 solute carrier family 16 member 5 2 2
MIRT617318 DPF3 double PHD fingers 3 2 2
MIRT617792 CHRM2 cholinergic receptor muscarinic 2 2 2
MIRT618418 DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 2 2
MIRT618663 RPP40 ribonuclease P/MRP subunit p40 2 2
MIRT620212 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620413 TFDP3 transcription factor Dp family member 3 2 2
MIRT620667 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620709 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT620956 SFT2D2 SFT2 domain containing 2 2 2
MIRT621225 LMAN1 lectin, mannose binding 1 2 2
MIRT621333 SLC11A1 solute carrier family 11 member 1 2 2
MIRT621696 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT623484 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623777 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT624215 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT624675 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT627369 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT628252 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT630790 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT635631 PRR15L proline rich 15 like 2 2
MIRT636425 MARCH1 membrane associated ring-CH-type finger 1 2 2
MIRT637295 ACTN2 actinin alpha 2 2 2
MIRT637345 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT637842 SLC2A9 solute carrier family 2 member 9 2 2
MIRT638327 RCAN1 regulator of calcineurin 1 2 2
MIRT638375 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638751 EPHA4 EPH receptor A4 2 2
MIRT638965 ARHGAP6 Rho GTPase activating protein 6 2 2
MIRT639094 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT639172 CEP70 centrosomal protein 70 2 2
MIRT639254 SLC38A1 solute carrier family 38 member 1 2 4
MIRT639368 ZCCHC24 zinc finger CCHC-type containing 24 2 4
MIRT639504 CACNA1G calcium voltage-gated channel subunit alpha1 G 2 2
MIRT639644 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 2 2
MIRT640486 EXOC5 exocyst complex component 5 2 2
MIRT641424 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT641550 LIPG lipase G, endothelial type 2 2
MIRT642180 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT642656 RGS6 regulator of G protein signaling 6 2 2
MIRT642873 SAMD1 sterile alpha motif domain containing 1 2 2
MIRT643355 TRIM10 tripartite motif containing 10 2 2
MIRT643531 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT643998 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644105 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 2
MIRT644421 VDR vitamin D receptor 2 2
MIRT644481 SLFN12 schlafen family member 12 2 2
MIRT644573 SPOP speckle type BTB/POZ protein 2 2
MIRT645354 SPNS1 sphingolipid transporter 1 (putative) 2 2
MIRT645383 FBLIM1 filamin binding LIM protein 1 2 2
MIRT645758 SURF6 surfeit 6 2 2
MIRT646060 VANGL2 VANGL planar cell polarity protein 2 2 2
MIRT646194 DUSP10 dual specificity phosphatase 10 2 2
MIRT647915 RGS5 regulator of G protein signaling 5 2 2
MIRT649216 AMMECR1L AMMECR1 like 2 2
MIRT649265 C17orf64 chromosome 17 open reading frame 64 2 2
MIRT649522 GTF3C3 general transcription factor IIIC subunit 3 2 2
MIRT649605 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650392 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT650835 SEMA4G semaphorin 4G 2 2
MIRT651273 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT651674 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT651763 VASP vasodilator stimulated phosphoprotein 2 2
MIRT652250 TPD52L3 tumor protein D52 like 3 2 2
MIRT652277 TOM1L2 target of myb1 like 2 membrane trafficking protein 2 2
MIRT652316 TNFSF15 TNF superfamily member 15 2 2
MIRT652342 TMOD3 tropomodulin 3 2 2
MIRT652373 TMEM57 transmembrane protein 57 2 2
MIRT652438 TMEM236 transmembrane protein 236 2 2
MIRT652723 TGFB2 transforming growth factor beta 2 2 2
MIRT652752 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT653310 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT653327 SMIM18 small integral membrane protein 18 2 2
MIRT653406 SLC7A2 solute carrier family 7 member 2 2 2
MIRT653512 SLC41A1 solute carrier family 41 member 1 2 2
MIRT653912 SERPINC1 serpin family C member 1 2 2
MIRT654111 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654153 RORB RAR related orphan receptor B 2 2
MIRT654548 RAB14 RAB14, member RAS oncogene family 2 2
MIRT654920 POLR3D RNA polymerase III subunit D 2 2
MIRT655169 PHF19 PHD finger protein 19 2 2
MIRT655412 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT655784 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT655836 NGDN neuroguidin 2 2
MIRT656079 MTA3 metastasis associated 1 family member 3 2 2
MIRT656404 MCTP1 multiple C2 and transmembrane domain containing 1 2 2
MIRT656720 LMLN leishmanolysin like peptidase 2 2
MIRT656774 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT656922 KIAA1462 junctional cadherin 5 associated 2 2
MIRT657004 KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 2 2
MIRT657477 HCAR2 hydroxycarboxylic acid receptor 2 2 2
MIRT657539 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657911 GCC1 GRIP and coiled-coil domain containing 1 2 2
MIRT658478 EXOC8 exocyst complex component 8 2 2
MIRT658612 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT658823 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT658965 DNAJB5 DnaJ heat shock protein family (Hsp40) member B5 2 4
MIRT659706 CCDC93 coiled-coil domain containing 93 2 2
MIRT660034 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT660108 BTBD3 BTB domain containing 3 2 2
MIRT660697 AMOTL2 angiomotin like 2 2 2
MIRT660763 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT660884 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT660956 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661217 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT661596 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT661624 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT662430 EID2 EP300 interacting inhibitor of differentiation 2 2 2
MIRT664816 NOX5 NADPH oxidase 5 2 2
MIRT665548 UCHL5 ubiquitin C-terminal hydrolase L5 2 2
MIRT665815 TMEM161B transmembrane protein 161B 2 2
MIRT666668 RBM23 RNA binding motif protein 23 2 2
MIRT667995 HCFC2 host cell factor C2 2 2
MIRT668064 GPR180 G protein-coupled receptor 180 2 2
MIRT669056 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT669637 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT699368 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699882 RUNX1 runt related transcription factor 1 2 2
MIRT703834 ETV3 ETS variant 3 2 2
MIRT708528 ZNF177 zinc finger protein 177 2 2
MIRT709696 DMWD DM1 locus, WD repeat containing 2 2
MIRT710381 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT710639 GLUL glutamate-ammonia ligase 2 2
MIRT711584 SETD1A SET domain containing 1A 2 2
MIRT713208 FAM13A family with sequence similarity 13 member A 2 2
MIRT714129 IL20RB interleukin 20 receptor subunit beta 2 2
MIRT714204 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT714733 CCNO cyclin O 2 2
MIRT714761 ZNF462 zinc finger protein 462 2 2
MIRT715624 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715755 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT716075 RNF150 ring finger protein 150 2 2
MIRT716179 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT717450 RWDD2A RWD domain containing 2A 2 2
MIRT717866 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 2
MIRT720964 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT721564 SLC5A12 solute carrier family 5 member 12 2 2
MIRT722348 BAG2 BCL2 associated athanogene 2 2 2
MIRT723235 BTLA B and T lymphocyte associated 2 2
MIRT724018 LMBRD2 LMBR1 domain containing 2 2 2
MIRT724507 KLHL5 kelch like family member 5 2 2
MIRT725478 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4446 Aed Therapy sensitive High Epilepsy tissue
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4446 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-4446 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-4446 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-4446-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4446-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4446-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4446-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission