pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6767 |
Genomic Coordinates | chr16: 2445392 - 2445457 |
Description | Homo sapiens miR-6767 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6767-3p | |||||||||||||||||||||||||||
Sequence | 45| CCACGUGCUUCUCUUUCCGCAG |66 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
|||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RRP36 | ||||||||||||||||||||
Synonyms | C6orf153, dJ20C7.4 | ||||||||||||||||||||
Description | ribosomal RNA processing 36 | ||||||||||||||||||||
Transcript | NM_033112 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on RRP36 | |||||||||||||||||||||
3'UTR of RRP36 (miRNA target sites are highlighted) |
>RRP36|NM_033112|3'UTR 1 TAAGGAACTATCCTCTGCTCTGCCACTGCCCCAGGGAGACATGGATCTGTGAGGACAGATTTGGCCACGGCTGGTTTCCG 81 TTCAAGGGCAAGGATCACAGCTGCCCTTGAATCTCATTGCCTCAGAGAAGACTAGAGGGCTCTTGGACTATCCCTAGGGC 161 TACACAAGAATAGTTCAGCCTTCTGCCATGCCACACAGCCTCAGCTTGAATCTGGTTCATTGCGTCCTCGTGTTCTTCTC 241 TCATCCTTGCCTTAAACCAGGGATTCTGATACCGAAGAAGAGGGGCCAATGAAAACCATGGAGTCTGTTCGTGACTCCCA 321 GGGCTGGGACATTATGTAGGAGCCACTTCATAAACATTCTCTTTACTCATCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | BT474 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1395166. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 1
... - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al. - Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM1395166 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | BT474 / BT474 AGO HITS-CLIP Replicate 1 |
Location of target site | ENST00000244496.5 | 3UTR | UGGUGGCACGUGCCUGUAGUCCCAGCUACUCAGGAGGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24906430 / GSE57855 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
42 hsa-miR-6767-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT066671 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | 2 | 4 | ||||||||
MIRT442663 | GLRA2 | glycine receptor alpha 2 | 2 | 2 | ||||||||
MIRT457038 | S1PR3 | sphingosine-1-phosphate receptor 3 | 2 | 2 | ||||||||
MIRT487824 | HIST1H2AH | histone cluster 1 H2A family member h | 2 | 6 | ||||||||
MIRT500161 | CLEC2D | C-type lectin domain family 2 member D | 2 | 8 | ||||||||
MIRT505924 | RCAN3 | RCAN family member 3 | 2 | 4 | ||||||||
MIRT529861 | GPR173 | G protein-coupled receptor 173 | 2 | 2 | ||||||||
MIRT569240 | SUSD1 | sushi domain containing 1 | 2 | 2 | ||||||||
MIRT575091 | Slc1a5 | solute carrier family 1 (neutral amino acid transporter), member 5 | 2 | 5 | ||||||||
MIRT575972 | Slfn5 | schlafen 5 | 2 | 3 | ||||||||
MIRT606881 | SLC1A5 | solute carrier family 1 member 5 | 2 | 7 | ||||||||
MIRT607097 | SLFN5 | schlafen family member 5 | 2 | 3 | ||||||||
MIRT607990 | NSUN3 | NOP2/Sun RNA methyltransferase family member 3 | 2 | 6 | ||||||||
MIRT608479 | RRP36 | ribosomal RNA processing 36 | 2 | 2 | ||||||||
MIRT610984 | GNA14 | G protein subunit alpha 14 | 2 | 2 | ||||||||
MIRT612308 | WDR37 | WD repeat domain 37 | 2 | 4 | ||||||||
MIRT612777 | MATN1 | matrilin 1, cartilage matrix protein | 2 | 4 | ||||||||
MIRT615030 | DNAL1 | dynein axonemal light chain 1 | 2 | 2 | ||||||||
MIRT615500 | MPP2 | membrane palmitoylated protein 2 | 2 | 2 | ||||||||
MIRT618026 | ELFN1 | extracellular leucine rich repeat and fibronectin type III domain containing 1 | 2 | 2 | ||||||||
MIRT618763 | HS6ST3 | heparan sulfate 6-O-sulfotransferase 3 | 2 | 2 | ||||||||
MIRT621458 | STX1B | syntaxin 1B | 2 | 2 | ||||||||
MIRT622221 | SLC36A1 | solute carrier family 36 member 1 | 2 | 2 | ||||||||
MIRT628784 | TMEM154 | transmembrane protein 154 | 2 | 2 | ||||||||
MIRT632385 | SNAPC3 | small nuclear RNA activating complex polypeptide 3 | 2 | 2 | ||||||||
MIRT652751 | TFAM | transcription factor A, mitochondrial | 2 | 2 | ||||||||
MIRT661806 | NUP85 | nucleoporin 85 | 2 | 2 | ||||||||
MIRT663148 | RD3 | retinal degeneration 3 | 2 | 2 | ||||||||
MIRT663867 | MUC20 | mucin 20, cell surface associated | 2 | 2 | ||||||||
MIRT664448 | CCDC108 | cilia and flagella associated protein 65 | 2 | 2 | ||||||||
MIRT669932 | LRPAP1 | LDL receptor related protein associated protein 1 | 2 | 2 | ||||||||
MIRT670303 | RBBP4 | RB binding protein 4, chromatin remodeling factor | 2 | 2 | ||||||||
MIRT672171 | FAM174B | family with sequence similarity 174 member B | 2 | 2 | ||||||||
MIRT672280 | SHE | Src homology 2 domain containing E | 2 | 2 | ||||||||
MIRT678057 | RPL7L1 | ribosomal protein L7 like 1 | 2 | 2 | ||||||||
MIRT679781 | GOLGA2 | golgin A2 | 2 | 2 | ||||||||
MIRT683451 | ACOT2 | acyl-CoA thioesterase 2 | 2 | 2 | ||||||||
MIRT684218 | C9orf64 | chromosome 9 open reading frame 64 | 2 | 2 | ||||||||
MIRT690932 | RAD51 | RAD51 recombinase | 2 | 2 | ||||||||
MIRT692944 | EXOSC2 | exosome component 2 | 2 | 2 | ||||||||
MIRT700401 | RAB13 | RAB13, member RAS oncogene family | 2 | 2 | ||||||||
MIRT724462 | PRKX | protein kinase, X-linked | 2 | 2 |