pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548t |
Genomic Coordinates | chr4: 173268160 - 173268233 |
Description | Homo sapiens miR-548t stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548t-3p | |||||||||||||||||||||||||||||||||||
Sequence | 46| AAAAACCACAAUUACUUUUGCACCA |70 | |||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NKTR | ||||||||||||||||||||
Synonyms | p104 | ||||||||||||||||||||
Description | natural killer cell triggering receptor | ||||||||||||||||||||
Transcript | NM_005385 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NKTR | |||||||||||||||||||||
3'UTR of NKTR (miRNA target sites are highlighted) |
>NKTR|NM_005385|3'UTR 1 AAACGTCCGGATACAAATTATATCTTATTTGTAAATATCTGGCAACTTAGCTTAAGAAATGTAATGACAGTCTGTTGTTC 81 TATTTCAATATCAGAGGTGAATTTCAAAAATAGACACTTCTTAATTGTTACTGGTTCATTTACATGTGGGGAGAAGAATT 161 TAAAATACAGATATGTCTCCTAAAAATATTTTTATGCCACATTTTACAGTAGCCAACTATGGAAATGAATTTCATTTTCT 241 TGAATCAAGAAATCGTGAAATTTATCTATGTATAATTTGCAATATTATTTTAAGTCTATTTCACTCTATCTTACGTATCC 321 CTTAGAATACAGATTCTTTTTGCCTGTTTTTCCAGTTTTAGCATATATGCTGCCAAGCATAGAACTGTGAAGGAGAACTG 401 TTAAAGGCGGCCAAATATTTATATACTGATTACATAGAGTCTTGTACATATGTGCTCTAAAAACAAACCACCCAGAATTG 481 ATACTGTTGGTAACCAGGAGTATAAGGCAGTGGCTCTGGGGTTCTTAATTCATTCCTAACTTCTTTGATACTTCACAGGA 561 TTAGGAAAGTGGTCATCATACATCCCACACAGTCTGTATTACTTCAGGCTTGTGGGCAAGGTTAGGAAGAATCAATCAGC 641 CTTAACTATAAATACCTGCACTGTCTCTGAGGACTTACTATTTTATGTTCTTTTTAATCAATACCGATCAGAAGTTTAGG 721 TTATAAAAACAATTCTACTTCATGCTTTGGTGCTTGGTAATTTTTGGTGCGTCTTTAAGCATTACTCTTATATATCATAT 801 ATTAAAATACCATAAAAATGAAATTCAGACAAAATCACTGGCACCAAAAATGGTTTATTCTGAGCTGTCTTCACTTTGAC 881 TATTTGGGGGGCTTCTCTCAAGTACAGATGTGGGTTGGGGTCCCCTGGAGCAGGCAGGATTGGCAGTAAGAGATATTGGC 961 CACTCAAGTCTACTGTGTGTGTGTGCCTCTGGAAGAGTGAAGAATGGACTTCAAAAGTAACATCAAAAATCTAACTGCCA 1041 CCATCCTGGAGACATTTTGCAGGGCTTTCCTTTCAAGTCTTTCAAGTACAGGATATTACCACAACAGCAGCTGAACTGTT 1121 GTAACCAGCATGTTTTTCCTATTTCCACTGTGACCTGCAGCTGACTCAAAGCCTTGCGTGACCTGACCCAGGTGCAAGAG 1201 ACAGGGGAAGAGGGATAGAGGGTATAGCATAAATTACATATTTTCATGGCTTTGGGTGGTTCCTCCAAAAATAATTGGAC 1281 CTGTAAAAACTAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTTTTTTTTTTTAATCTTTACTTTGAATTTGTT 1361 CCCCAAGTGTACTTAATCACCTTAGTGCCAGTTTAATCCAGTTATGCAGAAGAAATTCATATTGGTTGCCTGATGTAGAG 1441 CTCAGCACCACCCTACCACAGGCCTTGTCTGGTGTATTTGGGAAGTGGAAAAGAGCCCTCAGTTGGAGGGAGCTGACAAC 1521 CCTTGGTGGAGGGAGGGTGCCCTTGAATGTATTAAAACTATCACCCAAAGAAGGTATGAAAACAGGGTAAGGTGGTCAGT 1601 TGTTTGCCAGGTCAATAGACAGAAAGTACATTAGAAAACAGGACTTAGGCCAAACAAACAATACTGGATACTGAATACAA 1681 AACAGTATGATTTATATTAAAGGTTTCCAAAGGTTGCCTGCAAAGGAGAATATTACTACTAGTCAGCAGGAAAAAAATGC 1761 ATTCAGAACCCAAGCAGAAACTGCCAAATGTAATTAGGTTAAGAAAAGTTACCCTTGGGCAGTGTATTAGTTTTCTATTG 1841 CTGTGTGACAAATTACCCCAAATTTAGCAGTTTAAAAAACAATACCCATAGCAGTTCTGTAGCTCATGAGTCTGGCACAG 1921 TGTGGCTGGATTCTCTGCTCAGGGTCTTAAAGGCTGAAATAAGGGTTGGCAGGACAACATTCCTTCATGGAGGCTCTGGG 2001 GAAGAATCTGCTTCTAAGTTCATTCAGGTTGTTGGCGGAATTCAGTTCTTTGCTGGCTCTCAGCTGGAGGCCCCTCTCTC 2081 ACCTCAAGGCTGCCTGCATTCCTTCTTATGTGGTCCCCTCCAGCTTCAAACCAGCCTTCCTGCTCTTTCTCATGCTTCAT 2161 ATCTCTCTCCCGTCCTCCTGTTTTAGGGGCATATGATTAGCTCAAGCCCACAGATATATTTTAAGGTTGATTGTGCGATA 2241 GAACATAATTGCAGGAGTACTGTCTCATCTCATCATATTCACGGGTTCTGGAGATTAGCTCATTGAAAGTGGGAGGGGCA 2321 TTTTCAAATTCTGCCTACCACAGGCAATAACTGCCCATCTCAGCTGTAGGTGGAATTTTTACCCAGAAAAGATAGGCCCT 2401 AGAAGCCTCATTTCTTTTCTCCATGGAAAAGGACAGCCCTCTGCTGCAGCGTTCAACTTGTGTGTTTACTGACAGAGTGA 2481 ACTACAGAAATAGCTTTTCTTCCTAAAGGGGATTGTTCTACATTTTGAAGTTATTTTTTAATAAAATTGAATTATGTTGT 2561 GTATTGTGCTTCTTAATAGGAAATGCATTATTGGACTGTTTTTGTAACATCCTGTTTATTGCAAATAGCTAGTATCGTTC 2641 AAAAACTGTATAAAATACTTTTGTACATATTAGCAATGTCTAATTTGTATACACTTCAGTTAAATTTCCCTAAAACTTGA 2721 AAGGGGACCTTGTAGAAATTAAAATATATACTTAGTCTAAGTCTGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | Hela | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2
HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3
HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3
HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4
HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | BT474 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1395166. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 1
... - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment. |
Article |
- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al. - Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Cardiac Tissues |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000232978.8 | 3UTR | AACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084042 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep2 |
Location of target site | ENST00000232978.8 | 3UTR | AAACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1084044 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep3 |
Location of target site | ENST00000232978.8 | 3UTR | AACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084045 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep3 |
Location of target site | ENST00000232978.8 | 3UTR | AAACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1084046 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep4 |
Location of target site | ENST00000232978.8 | 3UTR | AAACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000232978.8 | 3UTR | ACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000232978.8 | 3UTR | AAACUAGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGGUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1395166 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | BT474 / BT474 AGO HITS-CLIP Replicate 1 |
Location of target site | ENST00000232978.8 | 3UTR | GUGUGUGUGUGUGUGUGUGUGUGUGGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24906430 / GSE57855 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059365 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT072839 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076945 | PCGF2 | polycomb group ring finger 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT083941 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT085401 | ETS2 | ETS proto-oncogene 2, transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT109790 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114046 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 10 | ||||||
MIRT130165 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT150013 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT181258 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT205594 | NCL | nucleolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT222253 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT245653 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT250947 | CDK5R1 | cyclin dependent kinase 5 regulatory subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252497 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT271990 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT280804 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293803 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT318231 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT341455 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT347413 | CEBPG | CCAAT/enhancer binding protein gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT351860 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357983 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT377094 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT407303 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441564 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442364 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT443228 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT443404 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446055 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448277 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450822 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453016 | CCDC115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 17 | ||||||
MIRT454463 | PPP2R2B | protein phosphatase 2 regulatory subunit Bbeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT456360 | CITED2 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460007 | DNALI1 | dynein axonemal light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463154 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 6 | ||||||
MIRT463766 | YPEL2 | yippee like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468310 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470668 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT478517 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT480507 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484718 | INHBA | inhibin beta A subunit | ![]() |
![]() |
2 | 12 | ||||||
MIRT485494 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487302 | SLC38A9 | solute carrier family 38 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487771 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT491876 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT494304 | CEP120 | centrosomal protein 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495396 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495646 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496665 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496837 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498638 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503928 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506063 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT506582 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506606 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT506844 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508536 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509669 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT511170 | MBNL3 | muscleblind like splicing regulator 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512147 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512831 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514558 | XRCC3 | X-ray repair cross complementing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515856 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521848 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT525364 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT527120 | ARHGAP15 | Rho GTPase activating protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527271 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527439 | COL4A3 | collagen type IV alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT527658 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT528334 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT529033 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529321 | PDE5A | phosphodiesterase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT529677 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529846 | SMTN | smoothelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT530385 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530913 | GPR85 | G protein-coupled receptor 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531794 | KDR | kinase insert domain receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT532246 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532658 | CBX7 | chromobox 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533630 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534811 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT534975 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536588 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536779 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | ![]() |
![]() |
2 | 2 | ||||||
MIRT538764 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539294 | ANGEL2 | angel homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539621 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539651 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540347 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540413 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541396 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542916 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544710 | EIF5A | eukaryotic translation initiation factor 5A | ![]() |
![]() |
2 | 4 | ||||||
MIRT544998 | MFF | mitochondrial fission factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT553289 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553455 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT553782 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554656 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555104 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT557235 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560861 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561545 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT561554 | SLMO2 | PRELI domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563764 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565653 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568080 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568759 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569078 | CADM2 | cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569509 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571268 | CDKN2AIP | CDKN2A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571809 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572554 | DKK3 | dickkopf WNT signaling pathway inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573782 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT576441 | Ccdc115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 10 | ||||||
MIRT576712 | Slc30a3 | solute carrier family 30 (zinc transporter), member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT608377 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608484 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT610186 | FAM49A | family with sequence similarity 49 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT611631 | EDIL3 | EGF like repeats and discoidin domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613534 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616221 | PTPN11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622370 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624371 | CDK12 | cyclin dependent kinase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624995 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626875 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627737 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT628490 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633647 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634028 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT635923 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT638287 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641959 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643573 | CTNNA3 | catenin alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645180 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT647497 | ZNF639 | zinc finger protein 639 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647682 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648422 | MYOZ3 | myozenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650113 | ZCCHC9 | zinc finger CCHC-type containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651076 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT651415 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651456 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653619 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653637 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654896 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656483 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658016 | GABRA4 | gamma-aminobutyric acid type A receptor alpha4 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT658041 | FZD10 | frizzled class receptor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660093 | BTBD3 | BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663923 | MAGEF1 | MAGE family member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665882 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669051 | CEP128 | centrosomal protein 128 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669711 | AAGAB | alpha and gamma adaptin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT686812 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT689883 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693274 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT697056 | BCAR1 | BCAR1, Cas family scaffolding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT703297 | GID4 | GID complex subunit 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704087 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707719 | CDC6 | cell division cycle 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708136 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT709212 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710062 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712770 | POU6F2 | POU class 6 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715073 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715387 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717712 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|