>ABCF3|NM_018358|3'UTR
   1 GGCCACCAGGCTGAGGACTCGCCCAGGACATGGACTGGTCTCTCAGACCCCTGGGCCACCATGTAGGCCACCACTCCAGG
  81 CCGTGGACTTCCCCCAACTTGGGGACAGCCTTATTCCCAAATGTCTCTATCCTTTTGACTGGAGCATCTTCTGCACAACC
 161 TTGGGAGCCCATCCAAGGGTTGGTGAGGACTGGTCTCCCGGGGGTGGGGGTCTGGGGGGTACCCTCTGGGGTTATAGATT
 241 CCCCCACTGCCCCAGCTCTGACTGGACCCCAAGTGGCTGCTATGTAAATTAAATCTCTCCCCGCGTCTCAAAAAAAAAAA
 321 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acaUGUC-GUCC---GUGUCUGucc 5' |::| | || | ||||| Target 5' gacATGGACTGGTCTCTCAGACccc 3'	27 - 51	106.00	-9.70
2	miRNA 3' acaugucguccgugUCUGUCc 5' :||||| Target 5' ttcccccaacttggGGACAGc 3'	89 - 109	104.00	-10.85
3	miRNA 3' acauGUCGUCCGUGUCUGUCc 5' || || | |||:| | Target 5' aggcCACCACTC-CAGGCCGt 3'	65 - 84	100.00	-8.40

Mutant ID	Mutant Position	Mutant Source
COSM9614148	1	COSMIC
COSN506602	22	COSMIC
COSN30526227	45	COSMIC
COSN30542681	50	COSMIC
COSN31579924	278	COSMIC
COSN28820121	304	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1179158372	1	dbSNP
rs1411807960	3	dbSNP
rs1387193622	7	dbSNP
rs200428976	8	dbSNP
rs1162636873	9	dbSNP
rs745481564	13	dbSNP
rs1365992892	19	dbSNP
rs113607041	21	dbSNP
rs1306159021	22	dbSNP
rs1165798412	23	dbSNP
rs772762812	25	dbSNP
rs762769303	27	dbSNP
rs770603396	28	dbSNP
rs367743725	30	dbSNP
rs577625968	31	dbSNP
rs372643478	34	dbSNP
rs1362094650	38	dbSNP
rs753852021	40	dbSNP
rs761898486	41	dbSNP
rs1438465802	43	dbSNP
rs1206638853	44	dbSNP
rs1235827128	46	dbSNP
rs1472566471	51	dbSNP
rs1373339247	56	dbSNP
rs1020638634	60	dbSNP
rs10937164	63	dbSNP
rs961150226	64	dbSNP
rs1247969425	79	dbSNP
rs1033878765	83	dbSNP
rs1283565577	84	dbSNP
rs991011850	88	dbSNP
rs1228034194	90	dbSNP
rs1328298696	94	dbSNP
rs916624005	98	dbSNP
rs1222953051	110	dbSNP
rs968120242	122	dbSNP
rs958888672	123	dbSNP
rs773436250	130	dbSNP
rs1016446368	139	dbSNP
rs1423177072	143	dbSNP
rs1203657856	151	dbSNP
rs1413501979	152	dbSNP
rs963610341	155	dbSNP
rs1476654206	177	dbSNP
rs1374301959	184	dbSNP
rs1232408319	188	dbSNP
rs1190798953	192	dbSNP
rs1477199734	194	dbSNP
rs923929034	195	dbSNP
rs972000410	200	dbSNP
rs919258482	201	dbSNP
rs935368290	205	dbSNP
rs1053439320	210	dbSNP
rs59606796	211	dbSNP
rs6777562	215	dbSNP
rs571461772	220	dbSNP
rs538440392	225	dbSNP
rs1049609824	227	dbSNP
rs1218167920	231	dbSNP
rs889511392	233	dbSNP
rs1005293657	236	dbSNP
rs1038150482	239	dbSNP
rs943196094	253	dbSNP
rs1053632835	254	dbSNP
rs893695664	258	dbSNP
rs896811970	259	dbSNP
rs1398809378	265	dbSNP
rs993881781	271	dbSNP
rs1429352671	287	dbSNP
rs1035645488	296	dbSNP
rs1476814196	303	dbSNP
rs1003647810	304	dbSNP
rs1033415613	305	dbSNP
rs1354632202	306	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.

- Breast cancer research and treatment, 2014

miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.