miRTarBase - #MIRT608870


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol NR2E1   
Synonyms TLL, TLX, XTLL
Description nuclear receptor subfamily 2 group E member 1
Transcript NM_003269   
Expression
Putative miRNA Targets on NR2E1
3'UTR of NR2E1
(miRNA target sites are highlighted)		 
>NR2E1|NM_003269|3'UTR
   1 GCTCACAAGATACCCACTTTTCAGGATGGGACAGTATCAGATGAACTTCAACCCATGGAGAACAAGCCTCAACTAACAAA
  81 CCCTTCAGGAAGCATATACCGGGGAATGTGTAGCCTTCAGGAAAAAAATGCCAATTGACACAAAGCATTCCAGTAGCTAT
 161 GACCTGCCGCCCTGACCAGGATAGGGCGGGTGGGAAGGAGAGGGGTGCAACAGGACCGCCTGCACTGAAAACTCACTGCT
 241 GCCATGCCCTGGGAGGGGGCAAACTGGGGGTTGCCACAGGCCGTGCCATTCTGCCTCTTACCTGGAAGATCAGGCTGAAC
 321 GATCAAAAGCTGAAACATAAGTAGTGCTTTCTCTTCCTTTTTAGCATACAAAGTTTGGTAACCAAATATAGCTCTGTGTA
 401 TAACATCGTACTGCGGCCTTCAAAACTACGTTATGTTGGAGCATTTATTTTAAAAATAATGGTAGGTTTTAAATTAAAAG
 481 TGTTATCAAAAGTTTCCCCTCTATTGTAATACATTATTAAGTGGCCTTCAGAACTGAGTTAATAAGTGAAAAGTAGCTTA
 561 TGCCATGTGATTTGCTTTTTCTCTATCTTCTTTTTTCTTTTCTTTCTCTTTCTTTTGTTCTTTCTTCTTCTTTTTTAATA
 641 CCATAGGCCAGGCAACCTTGTCAAAGGAATTGATGGACAAAATGAGATTCTCACCAGGACTTCAGGTTGGATAACATGTC
 721 AAAAAGAGAAGAGCTTTACTAAAAGAACATAAGTCAAGGGAGGATGAATAAAAACAGCAAAACCAAATAAAGTGGAGATG
 801 AGTGATTGAGTGAGGTAGATTGCTGTCCCGTTAACATAGTGCTGAAACCAAAGGCAGTGGGGGTCCAAACTCGTGGTGCA
 881 GCAAGTCACACCAGACAGGAAACGAATATGGACGTAATTGCAGAAGGAACTTCAAGGAGATGAATGAATGCTAAAAGGGT
 961 TCTTGACTGATCCATTGCTAACAGCCTGAGACTCTTCAATGCCTTTCCGAAAACTGGTTTCTAGTAAAGCCTTGAATGAA
1041 CACACACACACACACACACACACACACACACACACACACACACACACACCGTCCTACACTTTAAGCTGCTCCTTTGGTAT
1121 GACTCTATACTTATGGAAATGTAGAAACAAACATTTTTAAATAGCTGCTGTACTTTTCACATTTTGATTTATTAGGTACT
1201 AGCACTGAGGAAAAAAAATTCAGCACTTGGACTATCATAGGATGAGTAAAACTTTTCTTGTACAAAGTGAATTAACTGAT
1281 TTGTGAAGTTAAAAGGTTGTACTCATTGTATTTACAAAGAATAAAAATATATTGAATTTAAATGAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaGUUCCAGGCGAC--ACUUGUGc 5'
            :|| | || :||  ||||||| 
Target 5' agTAAAG-CC-TTGAATGAACACa 3'
 1023 - 1044 148.00 -9.40
2 
miRNA  3' uaguUCCAGGC-GAC---ACUUGUGc 5'
              ||| ||| |||   |||| || 
Target 5' caacAGGACCGCCTGCACTGAAAACt 3'
 208 - 233 130.00 -11.02
3 
miRNA  3' uaGUUCCAGGCGAC--ACUUGUGc 5'
            |||||   | ||  ||||::| 
Target 5' ttCAAGG--AGATGAATGAATGCt 3'
 931 - 952 122.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30133554 11 COSMIC
COSN30466945 23 COSMIC
COSN30180801 113 COSMIC
COSN30143764 120 COSMIC
COSN30167796 141 COSMIC
COSN30193684 151 COSMIC
COSN30143487 168 COSMIC
COSN23391641 170 COSMIC
COSN24310620 181 COSMIC
COSN1322684 188 COSMIC
COSN9963587 331 COSMIC
COSN5163334 345 COSMIC
COSN4951518 430 COSMIC
COSN26896540 699 COSMIC
COSN29040778 1090 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1445886848 4 dbSNP
rs768543085 7 dbSNP
rs1478266675 8 dbSNP
rs776618769 11 dbSNP
rs762993565 25 dbSNP
rs766453152 28 dbSNP
rs1482190978 39 dbSNP
rs1170590583 40 dbSNP
rs1243638081 44 dbSNP
rs774734793 47 dbSNP
rs1345754871 52 dbSNP
rs561108161 54 dbSNP
rs1056729752 61 dbSNP
rs1283748223 64 dbSNP
rs1021158610 66 dbSNP
rs968304284 68 dbSNP
rs895450764 73 dbSNP
rs1381786957 78 dbSNP
rs1324745219 87 dbSNP
rs1377170248 88 dbSNP
rs2233496 94 dbSNP
rs1400947938 97 dbSNP
rs1360488889 98 dbSNP
rs547085495 100 dbSNP
rs921455518 101 dbSNP
rs954254830 102 dbSNP
rs1417186862 115 dbSNP
rs1353907807 120 dbSNP
rs758378092 122 dbSNP
rs560670351 125 dbSNP
rs544163454 128 dbSNP
rs532712612 129 dbSNP
rs186243948 132 dbSNP
rs766482839 136 dbSNP
rs1036070617 141 dbSNP
rs919169168 151 dbSNP
rs930577381 152 dbSNP
rs1449822736 153 dbSNP
rs1224615109 157 dbSNP
rs1197817278 158 dbSNP
rs1000059805 161 dbSNP
rs1489546282 165 dbSNP
rs1238575721 167 dbSNP
rs1441372206 168 dbSNP
rs1048909253 169 dbSNP
rs905004044 170 dbSNP
rs569564003 179 dbSNP
rs1378740102 187 dbSNP
rs538141891 188 dbSNP
rs562701901 189 dbSNP
rs1407299451 190 dbSNP
rs1392007715 195 dbSNP
rs896606599 203 dbSNP
rs1455900285 208 dbSNP
rs956111456 218 dbSNP
rs574708385 219 dbSNP
rs1325900807 225 dbSNP
rs1019375371 246 dbSNP
rs964716915 248 dbSNP
rs1449520327 250 dbSNP
rs1306603205 251 dbSNP
rs975129887 255 dbSNP
rs1433718908 264 dbSNP
rs1334828350 267 dbSNP
rs142792213 269 dbSNP
rs1266702772 274 dbSNP
rs968252359 278 dbSNP
rs1354095958 283 dbSNP
rs1199499627 284 dbSNP
rs1212977185 295 dbSNP
rs1256573023 300 dbSNP
rs1235820784 316 dbSNP
rs1001049092 320 dbSNP
rs567937143 322 dbSNP
rs954321590 325 dbSNP
rs1331705205 332 dbSNP
rs768538556 333 dbSNP
rs1178353082 337 dbSNP
rs911629930 340 dbSNP
rs533893002 346 dbSNP
rs1196645541 349 dbSNP
rs1418729310 350 dbSNP
rs1431575720 352 dbSNP
rs1188270435 354 dbSNP
rs1179270609 355 dbSNP
rs1457500799 358 dbSNP
rs1236540182 364 dbSNP
rs971712180 369 dbSNP
rs1346124428 371 dbSNP
rs918951862 382 dbSNP
rs1231707428 383 dbSNP
rs1356390373 397 dbSNP
rs930317079 403 dbSNP
rs1370260315 407 dbSNP
rs868627398 408 dbSNP
rs553413524 409 dbSNP
rs1335750719 410 dbSNP
rs776408034 415 dbSNP
rs576518806 416 dbSNP
rs1401724352 417 dbSNP
rs1455293908 430 dbSNP
rs539292799 431 dbSNP
rs896548522 434 dbSNP
rs1329765846 444 dbSNP
rs1439130363 452 dbSNP
rs1236632656 461 dbSNP
rs1443423273 462 dbSNP
rs555916034 474 dbSNP
rs1255911841 481 dbSNP
rs1044440862 492 dbSNP
rs1199037642 497 dbSNP
rs1372074946 500 dbSNP
rs1396262382 507 dbSNP
rs1489571908 511 dbSNP
rs904474215 514 dbSNP
rs935863656 515 dbSNP
rs945485940 522 dbSNP
rs1350840623 523 dbSNP
rs1360667507 535 dbSNP
rs1052946996 543 dbSNP
rs1338183574 549 dbSNP
rs1232189826 553 dbSNP
rs1331973923 554 dbSNP
rs576318433 555 dbSNP
rs1361135015 563 dbSNP
rs1009002359 567 dbSNP
rs1297481910 586 dbSNP
rs558146956 588 dbSNP
rs903835130 590 dbSNP
rs1405881270 591 dbSNP
rs1165010994 598 dbSNP
rs1368068462 609 dbSNP
rs761514012 612 dbSNP
rs1196457676 614 dbSNP
rs1028954501 618 dbSNP
rs541723756 621 dbSNP
rs1216510280 622 dbSNP
rs373695402 622 dbSNP
rs567208274 622 dbSNP
rs996223889 625 dbSNP
rs1291418017 629 dbSNP
rs1019810191 631 dbSNP
rs1355244254 638 dbSNP
rs1028064196 642 dbSNP
rs1220290312 644 dbSNP
rs952302740 645 dbSNP
rs983637125 654 dbSNP
rs1015061561 657 dbSNP
rs1277565038 660 dbSNP
rs1398078273 667 dbSNP
rs966170124 671 dbSNP
rs1325637712 684 dbSNP
rs960838838 685 dbSNP
rs373204674 695 dbSNP
rs1390344424 701 dbSNP
rs1163032604 705 dbSNP
rs1467571455 705 dbSNP
rs1424788443 708 dbSNP
rs759750906 722 dbSNP
rs1187343902 731 dbSNP
rs1477139874 753 dbSNP
rs574696139 762 dbSNP
rs1199001816 764 dbSNP
rs917035008 765 dbSNP
rs951650756 768 dbSNP
rs948467993 770 dbSNP
rs926523916 773 dbSNP
rs979832625 794 dbSNP
rs1216519692 798 dbSNP
rs769380121 800 dbSNP
rs935916775 803 dbSNP
rs144504773 804 dbSNP
rs1437347673 809 dbSNP
rs1330587845 811 dbSNP
rs917733672 830 dbSNP
rs945224100 831 dbSNP
rs1401237672 838 dbSNP
rs1466932259 840 dbSNP
rs1304191131 852 dbSNP
rs1408541708 854 dbSNP
rs772713518 856 dbSNP
rs760431400 857 dbSNP
rs1173656981 858 dbSNP
rs1399675963 873 dbSNP
rs1413574726 874 dbSNP
rs944583018 877 dbSNP
rs1040601064 891 dbSNP
rs1298282398 893 dbSNP
rs900622364 896 dbSNP
rs936673135 897 dbSNP
rs1196574995 899 dbSNP
rs1294854827 904 dbSNP
rs1312528775 905 dbSNP
rs762410001 907 dbSNP
rs1235210859 914 dbSNP
rs1279322868 914 dbSNP
rs148425616 915 dbSNP
rs890023559 919 dbSNP
rs1008505324 924 dbSNP
rs1377977121 936 dbSNP
rs1330791925 949 dbSNP
rs1210168998 954 dbSNP
rs1361410202 959 dbSNP
rs1335529889 963 dbSNP
rs1020306841 975 dbSNP
rs1489343565 986 dbSNP
rs1027665357 998 dbSNP
rs887752492 1003 dbSNP
rs1005111390 1007 dbSNP
rs1015154754 1009 dbSNP
rs960932242 1010 dbSNP
rs994338287 1011 dbSNP
rs1013788010 1030 dbSNP
rs1268442352 1031 dbSNP
rs1440453518 1033 dbSNP
rs1287938380 1036 dbSNP
rs951808295 1037 dbSNP
rs1451823541 1038 dbSNP
rs1192404543 1039 dbSNP
rs1397637963 1039 dbSNP
rs35935361 1039 dbSNP
rs1006285759 1040 dbSNP
rs1172098078 1040 dbSNP
rs1213977568 1040 dbSNP
rs1217071262 1040 dbSNP
rs1228200369 1040 dbSNP
rs1233242127 1040 dbSNP
rs1260350605 1040 dbSNP
rs1264990412 1040 dbSNP
rs1280411663 1040 dbSNP
rs1313567489 1040 dbSNP
rs1323547622 1040 dbSNP
rs1353364210 1040 dbSNP
rs1354125541 1040 dbSNP
rs1439586313 1040 dbSNP
rs373693807 1040 dbSNP
rs1288198480 1042 dbSNP
rs1340355595 1043 dbSNP
rs1368246954 1043 dbSNP
rs1033374370 1049 dbSNP
rs1024221372 1050 dbSNP
rs1298931547 1054 dbSNP
rs1163478897 1056 dbSNP
rs1345919540 1056 dbSNP
rs1233820669 1057 dbSNP
rs1459750805 1057 dbSNP
rs141644858 1058 dbSNP
rs980229665 1060 dbSNP
rs1477359999 1062 dbSNP
rs1259446898 1068 dbSNP
rs992059957 1068 dbSNP
rs1489600217 1074 dbSNP
rs1266046808 1075 dbSNP
rs1241994298 1081 dbSNP
rs1489110242 1084 dbSNP
rs925626794 1086 dbSNP
rs1193230141 1087 dbSNP
rs1332847831 1087 dbSNP
rs1260531260 1089 dbSNP
rs957048896 1089 dbSNP
rs17069347 1091 dbSNP
rs913185017 1092 dbSNP
rs1454162432 1109 dbSNP
rs1158845113 1112 dbSNP
rs1401905452 1115 dbSNP
rs1381837583 1118 dbSNP
rs552840107 1128 dbSNP
rs1465066005 1129 dbSNP
rs1040207956 1131 dbSNP
rs921729033 1132 dbSNP
rs932100824 1134 dbSNP
rs1049113098 1135 dbSNP
rs1398408062 1137 dbSNP
rs150509040 1142 dbSNP
rs1435055247 1145 dbSNP
rs1350334050 1149 dbSNP
rs1193299096 1150 dbSNP
rs1459390827 1153 dbSNP
rs1199769340 1154 dbSNP
rs765385675 1154 dbSNP
rs1050174745 1166 dbSNP
rs911203766 1173 dbSNP
rs1235881817 1176 dbSNP
rs1447292163 1181 dbSNP
rs944051567 1200 dbSNP
rs1041267620 1211 dbSNP
rs1379422348 1211 dbSNP
rs1378422988 1213 dbSNP
rs1331465744 1220 dbSNP
rs765783732 1223 dbSNP
rs1304579891 1226 dbSNP
rs994336889 1231 dbSNP
rs1376901236 1235 dbSNP
rs1283654444 1237 dbSNP
rs1036314357 1241 dbSNP
rs1048619550 1244 dbSNP
rs1382189259 1245 dbSNP
rs1179346456 1246 dbSNP
rs1322468503 1248 dbSNP
rs190616445 1254 dbSNP
rs887514136 1258 dbSNP
rs1202755590 1263 dbSNP
rs752146729 1272 dbSNP
rs1483765387 1276 dbSNP
rs1280103291 1289 dbSNP
rs1231561280 1290 dbSNP
rs1355420980 1291 dbSNP
rs1171345964 1293 dbSNP
rs548554049 1297 dbSNP
rs577995801 1299 dbSNP
rs568059943 1300 dbSNP
rs1333535420 1302 dbSNP
rs1314739335 1303 dbSNP
rs1005941747 1304 dbSNP
rs1014216035 1305 dbSNP
rs1374576420 1307 dbSNP
rs1468301127 1329 dbSNP
rs543468308 1333 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395164. RNA binding protein: AGO. Condition:MCF7 AGO HITS-CLIP Replicate 2 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000368986.4 | 3UTR | UGAACACACACACACACACACACACACACACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000368986.4 | 3UTR | GAAUGAACACACACACACACACACACACACACACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000368986.4 | 3UTR | AAUGAACACACACACACACACACACACACACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000368986.4 | 3UTR | UGAACACACACACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000368986.4 | 3UTR | GAAUGAACACACACACACACACACACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000368986.4 | 3UTR | UGAACACACACACACACACACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1395164
Method / RBP HITS-CLIP / AGO
Cell line / Condition MCF7 / MCF7 AGO HITS-CLIP Replicate 2
Location of target site ENST00000368986.4 | 3UTR | UGAACACACACACACACACACACACACACACACACACACACACACACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease 0.449 1.2e-2 0.416 1.9e-2 25 Click to see details
GSE28544 Breast cancer -0.411 2.3e-2 -0.408 2.4e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.209 4.9e-2 -0.026 4.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.431 8.1e-2 0.175 2.9e-1 12 Click to see details
GSE17498 Multiple myeloma 0.193 1.2e-1 0.177 1.4e-1 40 Click to see details
GSE38226 Liver fibrosis -0.255 1.3e-1 -0.372 4.8e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.172 2.1e-1 -0.220 1.5e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.165 3.0e-1 -0.269 1.9e-1 13 Click to see details
GSE32688 Pancreatic cancer -0.098 3.0e-1 -0.084 3.2e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.039 4.4e-1 0.006 4.9e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.003 4.9e-1 0.122 2.9e-1 23 Click to see details
GSE42095 Differentiated embryonic stem cells 0.003 4.9e-1 0.122 2.9e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
0.003 4.9e-1 0.122 2.9e-1 23 Click to see details
0.003 4.9e-1 0.122 2.9e-1 23 Click to see details
0.003 4.9e-1 0.122 2.9e-1 23 Click to see details
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission