pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-500b |
Genomic Coordinates | chrX: 50010672 - 50010750 |
Description | Homo sapiens miR-500b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||
---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-500b-3p | ||||||
Sequence | 51| GCACCCAGGCAAGGAUUCUG |70 | ||||||
Evidence | Experimental | ||||||
Experiments | Illumina | ||||||
SNPs in miRNA |
|
||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NUDT3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | DIPP, DIPP-1, DIPP1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | nudix hydrolase 3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_006703 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on NUDT3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of NUDT3 (miRNA target sites are highlighted) |
>NUDT3|NM_006703|3'UTR 1 CTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAACTAGACTGAAGTGCAAATCTTCCCTCTCACCCTGGCTCTTTCCA 81 CTTCTCACAGGCCTCCTCTTTCAAATAAGGCATGGTGGGCAGCAAAGAAAGGGTGTATTGATAATGTTGCTGTTTGGTGT 161 TAAGTGATGGGGCTTTTTCTTCTGTTTTTATTGAGGGTGGGGGTTGGGTGTGTAATTTGTAAGTACTTTTGTGCATGATC 241 TGTCCCTCCCTCTTCCCACCCCTGCAGTCCTCTGAAGAGAGGCCAACAGCCTTCCCCTGCCTTGGATTCTGAAGTGTTCC 321 TGTTTGTCTTATCCTGGCCCTGGCCAGACGTTTTCTTTGATTTTTAATTTTTTTTTTTTATTAAAAGATACCAGTATGAG 401 ATGAAAACTTCCAATAATTTGTCCTATAATGTGCTGTACAGTTCAGTAGAGTGGTCACTTTCACTGCAGTATACATTTAT 481 CTACACATTATATATCGGACATATAATATGTAAATAAATGACTTCTAGAAAGAGAAATTTGTTTAATTTTTCAAGGTTTT 561 TTTCTCTTTTAATTTGGGCATTTCTAGAATTGAGAGCCTCACAATTAACATACCTTTTTGTTTTCGATGCTAGTGGCTGG 641 GCAGGTTGCCCTGTCCTTTCTCTATTTCCCAGTCATTGACTGTAGATATGGGAAGAGTTTAGCTACCTTCATAGTGCTCC 721 CAGGACTCATGGCCTTTCCTTCTTTAAGCTGTATTTCCCTGCCCAGAAAGAAACAGGAAGAAACCTTTTTTTATTTTTTT 801 ATTTTTTTTTAACCAAGCAAGGAGCAAATGGCCTCAGCCCAGATCTGTAAAAACAATGATAGAAATTGAATTCTGCCCCA 881 CATGTTGACAGTAGAGTTGGAACTGGATTCTTGGGATTACTTATCTAAAAAACTGGAGCATCAGGTCCATTTCTGTTCTG 961 CTGGTTTGGAATCTTTTCCGTAATGCTATTTATTGCCAACAATGGCCTCTCTTTGTGTCCATATATGCCTTACACCGTGC 1041 TGACCTGGGTATCATCCATGTGCTCTGAAGCATCCAACTTTACTTTGCAGGTGCATCAATGTAGTCCTGTCCCTGAACTG 1121 AGTAACCGTGTTCCTGAAAAGTACACTAGGGAAATTCACCTGCTTGCTTGTCTTTGTATTGGCATGGCACTTGTGATTGC 1201 ACCATGGAGCATGCTCAGAGCTATTAAATTGGTCTCCCATCTCCCACCAGGATATGAAAGGTCCATATGGGAGGCCACGT 1281 AATCACTTATTACAGTGGTTACATAATACACTGGCTCACTGCAGACTCTCTTGTTTTTTGATACAGTTTCGTGCTGGCTT 1361 CATTTGCCAATTGTGTTGTTTAGTTCGGAAGTAAGAGGGTCTTGAGATTGAGGGGTAGGGAGGGCTACACTGACTGATCC 1441 GTGGCTTAAGACAGGAGATTATCTCTGTACTCCAGTGGCATCTCCTTAGCCAAGATGTGAAATTAAAATCATAGTTCGCC 1521 TCATTTAAAAATTCTAATAAAGCACTCAAACTTTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb
HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb
HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb
HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084046 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep4 |
Location of target site | ENST00000607016.1 | 3UTR | CUGGGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000607016.1 | 3UTR | CUCUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000607016.1 | 3UTR | CUCUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084066 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SantaCruzAb |
Location of target site | ENST00000607016.1 | 3UTR | CUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1084073 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000607016.1 | 3UTR | CUGGGUGUGUGUGUGUGUAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1084076 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_SigmaAb |
Location of target site | ENST00000607016.1 | 3UTR | UCUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1084078 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000607016.1 | 3UTR | UCUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1084083 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SigmaAb |
Location of target site | ENST00000607016.1 | 3UTR | CUGGGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059905 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT235394 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT442246 | PYGO1 | pygopus family PHD finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443591 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 4 | ||||||
MIRT453280 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463540 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT465589 | TNRC6B | trinucleotide repeat containing 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT469462 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT485449 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486682 | WDR81 | WD repeat domain 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489078 | POLM | DNA polymerase mu | ![]() |
![]() |
2 | 2 | ||||||
MIRT493734 | GREM2 | gremlin 2, DAN family BMP antagonist | ![]() |
![]() |
2 | 2 | ||||||
MIRT494872 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496130 | RNF103-CHMP3 | RNF103-CHMP3 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT496489 | CHMP3 | charged multivesicular body protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496924 | CLMN | calmin | ![]() |
![]() |
2 | 2 | ||||||
MIRT497297 | TMEM119 | transmembrane protein 119 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499103 | AGRN | agrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT508979 | CXorf38 | chromosome X open reading frame 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509911 | NIPAL1 | NIPA like domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512820 | ARRDC2 | arrestin domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512827 | KBTBD6 | kelch repeat and BTB domain containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515360 | MRPL52 | mitochondrial ribosomal protein L52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516610 | TRIM58 | tripartite motif containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517053 | TLDC1 | TBC/LysM-associated domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517637 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518270 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518625 | STAR | steroidogenic acute regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT518887 | N4BP2L2 | NEDD4 binding protein 2 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519026 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT520365 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521106 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521943 | PHC3 | polyhomeotic homolog 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522253 | NPEPPS | aminopeptidase puromycin sensitive | ![]() |
![]() |
2 | 2 | ||||||
MIRT522853 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522868 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524207 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT526004 | ARHGAP27 | Rho GTPase activating protein 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527769 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT527827 | TMEM74B | transmembrane protein 74B | ![]() |
![]() |
2 | 2 | ||||||
MIRT527861 | SMOC1 | SPARC related modular calcium binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528040 | WT1 | Wilms tumor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529802 | ZDHHC8 | zinc finger DHHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531723 | TARS | threonyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT531996 | BARD1 | BRCA1 associated RING domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533338 | UNC119B | unc-119 lipid binding chaperone B | ![]() |
![]() |
2 | 2 | ||||||
MIRT533621 | TNFRSF13C | TNF receptor superfamily member 13C | ![]() |
![]() |
2 | 2 | ||||||
MIRT533652 | TMOD2 | tropomodulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534397 | SENP3 | SUMO1/sentrin/SMT3 specific peptidase 3 | ![]() |
![]() |
2 |