miRTarBase - #MIRT609212


—
pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PELP1   
Synonyms MNAR, P160
Description proline, glutamate and leucine rich protein 1
Transcript NM_014389   
Expression
Putative miRNA Targets on PELP1
3'UTR of PELP1
(miRNA target sites are highlighted)		 
>PELP1|NM_014389|3'UTR
   1 CCATCTTCTGCACCCCACTCTTTGTTTCCAATAAAGTTATGTCCTTAGATAGCGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31507895 53 COSMIC
COSN7436778 580 COSMIC
COSN5417087 924 COSMIC
COSN17965711 1067 COSMIC
COSN25286905 1281 COSMIC
COSN16288780 1458 COSMIC
COSN7436775 1552 COSMIC
COSN1720573 1577 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs574153069 3 dbSNP
rs563761032 6 dbSNP
rs757447049 12 dbSNP
rs754009522 15 dbSNP
rs1350637406 17 dbSNP
rs1386134570 18 dbSNP
rs180820752 20 dbSNP
rs774515667 22 dbSNP
rs112821844 23 dbSNP
rs1285004656 24 dbSNP
rs1447649702 30 dbSNP
rs1217298703 36 dbSNP
rs558211284 40 dbSNP
rs188304849 43 dbSNP
rs759052254 46 dbSNP
rs1255729051 53 dbSNP
rs1462500653 61 dbSNP
rs1183924973 62 dbSNP
rs1362990925 65 dbSNP
rs1468595369 68 dbSNP
rs1160223428 74 dbSNP
rs982074254 87 dbSNP
rs1413351359 91 dbSNP
rs1200057770 92 dbSNP
rs1020194827 104 dbSNP
rs781228012 111 dbSNP
rs957038951 113 dbSNP
rs1253432497 123 dbSNP
rs957561293 128 dbSNP
rs1307387820 130 dbSNP
rs1032607418 132 dbSNP
rs1416143543 133 dbSNP
rs1352989692 163 dbSNP
rs1032081956 167 dbSNP
rs768314992 173 dbSNP
rs573222314 174 dbSNP
rs1391601915 175 dbSNP
rs902151339 176 dbSNP
rs1325987967 179 dbSNP
rs1165873346 186 dbSNP
rs1204536167 186 dbSNP
rs1249640904 187 dbSNP
rs746463142 190 dbSNP
rs552996886 195 dbSNP
rs1008522351 196 dbSNP
rs1479842349 197 dbSNP
rs896649197 200 dbSNP
rs1430759998 206 dbSNP
rs114959465 211 dbSNP
rs996620872 220 dbSNP
rs1396228309 223 dbSNP
rs940887812 228 dbSNP
rs1331481089 229 dbSNP
rs909224313 230 dbSNP
rs1415091651 231 dbSNP
rs1404842517 241 dbSNP
rs779588439 245 dbSNP
rs1281521007 246 dbSNP
rs898355440 260 dbSNP
rs1224364564 267 dbSNP
rs28361461 268 dbSNP
rs1337229659 281 dbSNP
rs1197292666 282 dbSNP
rs1273410030 283 dbSNP
rs1438552497 288 dbSNP
rs931981457 289 dbSNP
rs922036649 295 dbSNP
rs1253106713 300 dbSNP
rs976183163 306 dbSNP
rs1480439713 311 dbSNP
rs1192037500 312 dbSNP
rs1370931901 313 dbSNP
rs1460814597 315 dbSNP
rs750043311 316 dbSNP
rs1371547501 318 dbSNP
rs1301769973 319 dbSNP
rs908506390 322 dbSNP
rs1405580667 324 dbSNP
rs779294837 326 dbSNP
rs988699301 327 dbSNP
rs1045736491 328 dbSNP
rs950135949 329 dbSNP
rs556992182 332 dbSNP
rs1332109116 335 dbSNP
rs957258732 338 dbSNP
rs1032659047 339 dbSNP
rs991768783 342 dbSNP
rs757565484 346 dbSNP
rs1337117919 356 dbSNP
rs1490375872 357 dbSNP
rs754370069 361 dbSNP
rs1390652052 366 dbSNP
rs1394903275 370 dbSNP
rs1203991537 380 dbSNP
rs1259015262 388 dbSNP
rs1327920868 396 dbSNP
rs1001633276 399 dbSNP
rs184636732 400 dbSNP
rs147617474 405 dbSNP
rs1415787197 406 dbSNP
rs1458839216 406 dbSNP
rs979141473 408 dbSNP
rs1382865387 410 dbSNP
rs966488218 411 dbSNP
rs551000386 412 dbSNP
rs554231940 430 dbSNP
rs1013965416 434 dbSNP
rs113002486 435 dbSNP
rs896663543 439 dbSNP
rs1007885348 443 dbSNP
rs1243430832 459 dbSNP
rs182219815 461 dbSNP
rs1028222285 470 dbSNP
rs1238209823 476 dbSNP
rs1254010165 486 dbSNP
rs1005154952 487 dbSNP
rs898307838 495 dbSNP
rs1038176199 497 dbSNP
rs1288569651 503 dbSNP
rs1004216855 508 dbSNP
rs780718663 513 dbSNP
rs1387450092 515 dbSNP
rs752872312 517 dbSNP
rs1049327887 529 dbSNP
rs1046269726 532 dbSNP
rs1238966079 534 dbSNP
rs1321493153 538 dbSNP
rs1405569081 539 dbSNP
rs1450678552 541 dbSNP
rs1371530657 544 dbSNP
rs932007811 546 dbSNP
rs1379604024 547 dbSNP
rs142612394 552 dbSNP
rs1318225061 553 dbSNP
rs767465293 556 dbSNP
rs1239094515 559 dbSNP
rs190117312 563 dbSNP
rs1205163314 569 dbSNP
rs148494385 571 dbSNP
rs913081679 575 dbSNP
rs1401399708 584 dbSNP
rs1248973639 590 dbSNP
rs1387230702 591 dbSNP
rs1420984271 591 dbSNP
rs555249213 597 dbSNP
rs543877043 598 dbSNP
rs1428654603 600 dbSNP
rs1468485544 606 dbSNP
rs988581598 618 dbSNP
rs373879178 622 dbSNP
rs925900912 624 dbSNP
rs980036652 625 dbSNP
rs533505963 631 dbSNP
rs1375495986 633 dbSNP
rs564469059 645 dbSNP
rs774702071 646 dbSNP
rs913635849 650 dbSNP
rs1224969676 651 dbSNP
rs986975697 654 dbSNP
rs1313173863 658 dbSNP
rs144590477 665 dbSNP
rs1448292547 669 dbSNP
rs2135909 681 dbSNP
rs1215460252 689 dbSNP
rs761632408 691 dbSNP
rs1183513010 695 dbSNP
rs1268350697 699 dbSNP
rs111899245 701 dbSNP
rs372894154 706 dbSNP
rs149314579 708 dbSNP
rs1168116332 711 dbSNP
rs1356049971 713 dbSNP
rs573755832 713 dbSNP
rs1302399436 716 dbSNP
rs1363181060 720 dbSNP
rs760505004 720 dbSNP
rs1366606988 723 dbSNP
rs1293948950 724 dbSNP
rs886970265 729 dbSNP
rs556908662 730 dbSNP
rs8078044 740 dbSNP
rs1489890285 741 dbSNP
rs2174830 742 dbSNP
rs557437009 744 dbSNP
rs894448276 746 dbSNP
rs1475242952 752 dbSNP
rs185219588 766 dbSNP
rs779651663 770 dbSNP
rs536938211 776 dbSNP
rs192825418 780 dbSNP
rs1162874736 782 dbSNP
rs1363596012 784 dbSNP
rs1399667369 793 dbSNP
rs865866454 795 dbSNP
rs529588207 797 dbSNP
rs570215754 806 dbSNP
rs1323696311 811 dbSNP
rs1344074223 813 dbSNP
rs1428290641 814 dbSNP
rs752434267 833 dbSNP
rs1175730912 837 dbSNP
rs1290195952 838 dbSNP
rs1433286531 845 dbSNP
rs1424894558 846 dbSNP
rs1169054647 847 dbSNP
rs1357993141 850 dbSNP
rs779994051 856 dbSNP
rs1230514773 860 dbSNP
rs1446437197 861 dbSNP
rs1053120603 863 dbSNP
rs1250079267 864 dbSNP
rs1465205755 865 dbSNP
rs9915527 866 dbSNP
rs1383125778 867 dbSNP
rs1446428826 870 dbSNP
rs1042020375 871 dbSNP
rs1163764544 871 dbSNP
rs1485806748 872 dbSNP
rs1259233105 873 dbSNP
rs925786437 876 dbSNP
rs138306688 879 dbSNP
rs1336551421 880 dbSNP
rs1273377771 887 dbSNP
rs145842529 888 dbSNP
rs1337324551 889 dbSNP
rs916919586 890 dbSNP
rs1270057939 891 dbSNP
rs368224207 897 dbSNP
rs992529112 900 dbSNP
rs920892083 901 dbSNP
rs961016429 924 dbSNP
rs1443859120 926 dbSNP
rs6502805 936 dbSNP
rs1051990875 940 dbSNP
rs1356132928 941 dbSNP
rs1016794737 944 dbSNP
rs539374641 945 dbSNP
rs952191499 946 dbSNP
rs1024573193 950 dbSNP
rs1446070823 952 dbSNP
rs1404382277 953 dbSNP
rs1416473918 962 dbSNP
rs35301503 965 dbSNP
rs1027790754 967 dbSNP
rs1350619238 970 dbSNP
rs1014301102 976 dbSNP
rs996847610 986 dbSNP
rs1290356334 987 dbSNP
rs1351174000 995 dbSNP
rs527656214 1010 dbSNP
rs1261429187 1016 dbSNP
rs1346901124 1019 dbSNP
rs1200867436 1020 dbSNP
rs1272002022 1026 dbSNP
rs561966454 1029 dbSNP
rs1034467435 1031 dbSNP
rs1251914962 1032 dbSNP
rs1479793035 1035 dbSNP
rs1196867744 1041 dbSNP
rs1378960592 1047 dbSNP
rs1478132485 1049 dbSNP
rs542889421 1052 dbSNP
rs1396203121 1060 dbSNP
rs111582429 1062 dbSNP
rs72835644 1067 dbSNP
rs1170553995 1072 dbSNP
rs760142675 1074 dbSNP
rs890592760 1077 dbSNP
rs1052367792 1081 dbSNP
rs1185365315 1087 dbSNP
rs932209351 1091 dbSNP
rs114249064 1093 dbSNP
rs772755980 1094 dbSNP
rs941013587 1101 dbSNP
rs1206298412 1109 dbSNP
rs375510502 1114 dbSNP
rs1219666108 1118 dbSNP
rs1257384898 1119 dbSNP
rs72835643 1122 dbSNP
rs7222133 1123 dbSNP
rs1295139585 1124 dbSNP
rs917200573 1125 dbSNP
rs534434939 1126 dbSNP
rs958557300 1127 dbSNP
rs1034415181 1132 dbSNP
rs1000297797 1135 dbSNP
rs1392965497 1135 dbSNP
rs753141404 1135 dbSNP
rs1280527480 1140 dbSNP
rs571986734 1157 dbSNP
rs566271569 1158 dbSNP
rs1358699696 1160 dbSNP
rs759475913 1161 dbSNP
rs1266763366 1164 dbSNP
rs920781686 1170 dbSNP
rs1462372226 1174 dbSNP
rs1396039576 1175 dbSNP
rs1463846130 1176 dbSNP
rs1190964411 1177 dbSNP
rs77626245 1191 dbSNP
rs570206136 1192 dbSNP
rs965229823 1195 dbSNP
rs996737829 1204 dbSNP
rs900703516 1205 dbSNP
rs113844576 1207 dbSNP
rs1039404912 1208 dbSNP
rs573630069 1209 dbSNP
rs941127891 1210 dbSNP
rs1321043513 1211 dbSNP
rs1381758194 1214 dbSNP
rs766668012 1224 dbSNP
rs1314708500 1228 dbSNP
rs909519424 1229 dbSNP
rs1237653159 1237 dbSNP
rs1258411973 1242 dbSNP
rs550504654 1245 dbSNP
rs956043944 1246 dbSNP
rs148385233 1247 dbSNP
rs929691244 1251 dbSNP
rs1000254067 1254 dbSNP
rs904630181 1263 dbSNP
rs1044861066 1270 dbSNP
rs1258827688 1274 dbSNP
rs1424876791 1280 dbSNP
rs1469709736 1283 dbSNP
rs992781815 1285 dbSNP
rs571076664 1288 dbSNP
rs761720331 1289 dbSNP
rs978805630 1300 dbSNP
rs547887252 1301 dbSNP
rs1464312830 1308 dbSNP
rs1308059234 1319 dbSNP
rs4790672 1320 dbSNP
rs1379855695 1321 dbSNP
rs1390738759 1322 dbSNP
rs187172381 1326 dbSNP
rs72835642 1327 dbSNP
rs908222790 1334 dbSNP
rs1030985868 1337 dbSNP
rs1048070179 1339 dbSNP
rs1323319780 1340 dbSNP
rs531737266 1353 dbSNP
rs1208519230 1354 dbSNP
rs780675870 1356 dbSNP
rs113752380 1357 dbSNP
rs1258115900 1367 dbSNP
rs1373770486 1369 dbSNP
rs184320992 1371 dbSNP
rs900651037 1373 dbSNP
rs577389816 1383 dbSNP
rs563969550 1385 dbSNP
rs1183187986 1387 dbSNP
rs1421273244 1388 dbSNP
rs1428808981 1391 dbSNP
rs964947564 1395 dbSNP
rs912009116 1397 dbSNP
rs75859578 1398 dbSNP
rs1306046895 1399 dbSNP
rs1193982277 1402 dbSNP
rs1409865632 1416 dbSNP
rs572086948 1416 dbSNP
rs1282057967 1418 dbSNP
rs1046838403 1422 dbSNP
rs1220581187 1428 dbSNP
rs149211490 1435 dbSNP
rs1190520399 1445 dbSNP
rs1228325213 1446 dbSNP
rs200437536 1453 dbSNP
rs796818907 1453 dbSNP
rs535066855 1456 dbSNP
rs1484094835 1457 dbSNP
rs1206005020 1462 dbSNP
rs1261326624 1464 dbSNP
rs576002808 1465 dbSNP
rs1193068981 1472 dbSNP
rs1031866376 1476 dbSNP
rs1425625005 1484 dbSNP
rs1351734708 1488 dbSNP
rs1000181964 1490 dbSNP
rs1057404640 1491 dbSNP
rs1391998075 1511 dbSNP
rs556867123 1513 dbSNP
rs1302053275 1514 dbSNP
rs1235542374 1521 dbSNP
rs1023086815 1528 dbSNP
rs540162834 1529 dbSNP
rs1438170675 1530 dbSNP
rs978591327 1531 dbSNP
rs1368773119 1536 dbSNP
rs191369291 1543 dbSNP
rs1299907216 1544 dbSNP
rs548048481 1545 dbSNP
rs1386688824 1546 dbSNP
rs1056959109 1551 dbSNP
rs4790214 1555 dbSNP
rs1319942826 1560 dbSNP
rs767685781 1561 dbSNP
rs1224079378 1564 dbSNP
rs1290045877 1565 dbSNP
rs1397782048 1567 dbSNP
rs1359445538 1570 dbSNP
rs1173851858 1580 dbSNP
rs988936882 1583 dbSNP
rs954850853 1590 dbSNP
rs1450077865 1597 dbSNP
rs114852777 1599 dbSNP
rs1411007603 1602 dbSNP
rs1406548588 1612 dbSNP
rs542248111 1615 dbSNP
rs377378164 1617 dbSNP
rs1344279763 1618 dbSNP
rs1432413375 1619 dbSNP
rs574825882 1627 dbSNP
rs1367715622 1636 dbSNP
rs931029478 1640 dbSNP
rs899494222 1641 dbSNP
rs1436486247 1645 dbSNP
rs1428980878 1656 dbSNP
rs369672014 1660 dbSNP
rs71901601 1660 dbSNP
rs1377111173 1661 dbSNP
rs1230143199 1666 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1 HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1 HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2 HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1084040
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep1
Location of target site ENST00000574876.1 | 3UTR | CUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084041
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep1
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084042
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep2
Location of target site ENST00000574876.1 | 3UTR | CUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000574876.1 | 3UTR | CUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000574876.1 | 3UTR | CUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | ACUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084067
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SantaCruzAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | ACUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | ACUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1084076
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | CUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | ACUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000574876.1 | 3UTR | ACUACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 21 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 22 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 23 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000574876.1 | 3UTR | UACAUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.794 3.1e-6 0.649 4.0e-4 23 Click to see details
GSE28544 Breast cancer 0.521 4.5e-3 0.464 1.1e-2 24 Click to see details
GSE38226 Liver fibrosis -0.495 1.1e-2 -0.423 2.8e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.431 1.6e-2 -0.425 1.7e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.335 3.0e-2 -0.402 1.1e-2 32 Click to see details
GSE28260 Renal cortex and medulla 0.511 3.7e-2 0.537 2.9e-2 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.38 4.9e-2 0.271 1.2e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.469 6.2e-2 0.490 5.3e-2 12 Click to see details
GSE14794 Lymphoblastoid cells 0.105 1.6e-1 0.097 1.8e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.232 1.9e-1 -0.050 4.3e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.151 2.4e-1 0.259 1.1e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.415 2.4e-1 -0.500 2.0e-1 5 Click to see details
GSE21849 B cell lymphoma -0.114 2.8e-1 0.242 1.0e-1 29 Click to see details
GSE17306 Multiple myeloma 0.072 3.1e-1 0.465 3.8e-4 49 Click to see details
GSE17498 Multiple myeloma 0.061 3.5e-1 0.054 3.7e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.022 4.3e-1 -0.101 2.1e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.022 4.3e-1 -0.101 2.1e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission