miRTarBase - #MIRT609495


—
pre-miRNA Information
pre-miRNA hsa-mir-6819   
Genomic Coordinates chr22: 36286847 - 36286907
Description Homo sapiens miR-6819 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6819-3p
Sequence 41| AAGCCUCUGUCCCCACCCCAG |61
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1279530967 2 dbSNP
rs967579979 3 dbSNP
rs776891214 4 dbSNP
rs771166635 8 dbSNP
rs747037324 9 dbSNP
rs879248090 11 dbSNP
rs1485325191 12 dbSNP
rs778157316 16 dbSNP
Putative Targets

Gene Information
Gene Symbol DNASE1L3   
Synonyms DHP2, DNAS1L3, LSD, SLEB16
Description deoxyribonuclease 1 like 3
Transcript NM_004944   
Expression
Putative miRNA Targets on DNASE1L3
3'UTR of DNASE1L3
(miRNA target sites are highlighted)		 
>DNASE1L3|NM_004944|3'UTR
   1 ACCCAAGGGTCTCATCTTATTAACCATTTCTTGCCTCTAAATAAAATGTCTCTAACAGATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8892291 13 COSMIC
COSN14077178 30 COSMIC
COSN30494151 31 COSMIC
COSN1954593 122 COSMIC
COSN28835784 126 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781607897 1 dbSNP
rs765888878 2 dbSNP
rs891809699 4 dbSNP
rs1375812782 8 dbSNP
rs757098263 9 dbSNP
rs751426201 11 dbSNP
rs369219413 14 dbSNP
rs1186199699 19 dbSNP
rs758356463 20 dbSNP
rs571543105 24 dbSNP
rs532308549 28 dbSNP
rs1250015726 33 dbSNP
rs752086633 34 dbSNP
rs770717530 37 dbSNP
rs1159305504 45 dbSNP
rs764788522 49 dbSNP
rs760130295 52 dbSNP
rs1413720508 57 dbSNP
rs201385315 61 dbSNP
rs772885009 65 dbSNP
rs997177562 66 dbSNP
rs1032851070 67 dbSNP
rs1455115612 71 dbSNP
rs900168550 87 dbSNP
rs1301153006 93 dbSNP
rs1378453393 96 dbSNP
rs1001015664 99 dbSNP
rs1017188764 101 dbSNP
rs1042560741 110 dbSNP
rs1378110414 123 dbSNP
rs1011282674 146 dbSNP
rs891419323 162 dbSNP
rs116685574 163 dbSNP
rs1212229983 164 dbSNP
rs77435715 166 dbSNP
rs934496562 172 dbSNP
rs907155946 174 dbSNP
rs544694171 175 dbSNP
rs939776935 184 dbSNP
rs1456712795 186 dbSNP
rs1395514113 192 dbSNP
rs1167310696 194 dbSNP
rs1045645262 195 dbSNP
rs1430500774 198 dbSNP
rs574759432 201 dbSNP
rs948586401 205 dbSNP
rs915918565 215 dbSNP
rs1174493207 219 dbSNP
rs1359122395 224 dbSNP
rs772767812 225 dbSNP
rs971263886 227 dbSNP
rs1348822165 235 dbSNP
rs941440625 244 dbSNP
rs1287478833 250 dbSNP
rs1220744549 253 dbSNP
rs908612283 260 dbSNP
rs1276369993 263 dbSNP
rs915821873 263 dbSNP
rs1413491982 265 dbSNP
rs1187664951 266 dbSNP
rs34882513 269 dbSNP
rs1481860526 270 dbSNP
rs1180932134 272 dbSNP
rs1245737690 283 dbSNP
rs1269161129 289 dbSNP
rs1479184897 291 dbSNP
rs1189861350 296 dbSNP
rs959653536 297 dbSNP
rs561393492 298 dbSNP
rs541557369 299 dbSNP
rs1030361045 300 dbSNP
rs1274685866 314 dbSNP
rs975643115 320 dbSNP
rs572535224 323 dbSNP
rs559202386 324 dbSNP
rs1366784932 328 dbSNP
rs1215146155 334 dbSNP
rs891347087 337 dbSNP
rs763279279 340 dbSNP
rs377346731 361 dbSNP
rs187105769 362 dbSNP
rs996503012 363 dbSNP
rs892903194 369 dbSNP
rs1038070086 379 dbSNP
rs1273430400 380 dbSNP
rs1031419567 393 dbSNP
rs752454832 416 dbSNP
rs1246557281 417 dbSNP
rs1476021340 419 dbSNP
rs551518178 424 dbSNP
rs1388868997 428 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaccccACCCCUGUCUCCgaa 5'
                ||  |: :||||   
Target 5' ------UGCAGGGGGAGGaag 3'
 		1 - 15
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000486455.1 | 3UTR | UGCAGGGGGAGGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-6819-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT358318 PANK3 pantothenate kinase 3 2 2
MIRT454719 UBQLNL ubiquilin like 2 2
MIRT471362 PEG10 paternally expressed 10 2 2
MIRT478101 DLG5 discs large MAGUK scaffold protein 5 2 4
MIRT495554 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT495587 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT508315 RPL18 ribosomal protein L18 2 4
MIRT529183 ADAM33 ADAM metallopeptidase domain 33 2 2
MIRT532035 FHDC1 FH2 domain containing 1 2 2
MIRT545131 ANXA5 annexin A5 2 2
MIRT567288 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT568094 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT573291 DLX4 distal-less homeobox 4 2 2
MIRT575169 Fam120c family with sequence similarity 120, member C 2 2
MIRT609495 DNASE1L3 deoxyribonuclease 1 like 3 2 2
MIRT611264 EHD3 EH domain containing 3 2 2
MIRT613580 POC5 POC5 centriolar protein 2 2
MIRT616520 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT617098 ZNF667 zinc finger protein 667 2 2
MIRT618268 DDX51 DEAD-box helicase 51 2 2
MIRT618294 ZNF682 zinc finger protein 682 2 2
MIRT618617 SHOX short stature homeobox 2 2
MIRT619741 SRFBP1 serum response factor binding protein 1 2 2
MIRT619784 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT621119 SP110 SP110 nuclear body protein 2 2
MIRT622530 RAD51 RAD51 recombinase 2 2
MIRT623088 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623938 FKBP14 FK506 binding protein 14 2 2
MIRT624389 CD84 CD84 molecule 2 2
MIRT624860 ABI2 abl interactor 2 2 2
MIRT628752 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT632243 VTA1 vesicle trafficking 1 2 2
MIRT632987 E2F2 E2F transcription factor 2 2 2
MIRT633695 RBM43 RNA binding motif protein 43 2 2
MIRT633766 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633808 ZNF91 zinc finger protein 91 2 2
MIRT638914 CBLN2 cerebellin 2 precursor 2 2
MIRT641298 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT642123 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT642179 HEBP2 heme binding protein 2 2 2
MIRT642617 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT643325 TMEM151B transmembrane protein 151B 2 2
MIRT644534 TMEM134 transmembrane protein 134 2 2
MIRT645820 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT646093 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646861 SLC35E4 solute carrier family 35 member E4 2 2
MIRT647466 DZIP1L DAZ interacting zinc finger protein 1 like 2 2
MIRT647702 NADSYN1 NAD synthetase 1 2 2
MIRT648082 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648547 TMEM169 transmembrane protein 169 2 2
MIRT648690 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT649747 GNB5 G protein subunit beta 5 2 2
MIRT650154 ZNF426 zinc finger protein 426 2 2
MIRT650450 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650943 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651544 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT652304 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT652890 SYVN1 synoviolin 1 2 2
MIRT654222 RNF19B ring finger protein 19B 2 2
MIRT654676 PSMB5 proteasome subunit beta 5 2 2
MIRT658249 FAXC failed axon connections homolog 2 2
MIRT658363 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT659622 CELF1 CUGBP Elav-like family member 1 2 2
MIRT660171 BNIP3L BCL2 interacting protein 3 like 2 2
MIRT660634 ANKRD52 ankyrin repeat domain 52 2 2
MIRT662428 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT662984 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663939 ZNF554 zinc finger protein 554 2 2
MIRT666960 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT667945 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT668847 CYCS cytochrome c, somatic 2 2
MIRT671792 RGS17 regulator of G protein signaling 17 2 2
MIRT672382 RPL37 ribosomal protein L37 2 2
MIRT673516 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674716 FAM73A mitoguardin 1 2 2
MIRT676352 KLF8 Kruppel like factor 8 2 2
MIRT677820 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT678440 PDE4C phosphodiesterase 4C 2 2
MIRT678499 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT679243 LRP10 LDL receptor related protein 10 2 2
MIRT693607 SLC39A1 solute carrier family 39 member 1 2 2
MIRT695927 ZNF174 zinc finger protein 174 2 2
MIRT697987 TSPAN6 tetraspanin 6 2 2
MIRT700821 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701350 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT702348 KLHL7 kelch like family member 7 2 2
MIRT703387 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT703883 ERBB2IP erbb2 interacting protein 2 2
MIRT708237 PPP1R26 protein phosphatase 1 regulatory subunit 26 2 2
MIRT708629 NUDT18 nudix hydrolase 18 2 2
MIRT708990 CABP4 calcium binding protein 4 2 2
MIRT709804 FOXE1 forkhead box E1 2 2
MIRT710203 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT710248 VAMP1 vesicle associated membrane protein 1 2 2
MIRT710281 FGF1 fibroblast growth factor 1 2 2
MIRT712992 IRGQ immunity related GTPase Q 2 2
MIRT713887 MOB3A MOB kinase activator 3A 2 2
MIRT715600 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT715639 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715686 FRK fyn related Src family tyrosine kinase 2 2
MIRT717053 WIZ widely interspaced zinc finger motifs 2 2
MIRT717611 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT721539 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT722096 SUSD1 sushi domain containing 1 2 2
MIRT722435 HRNR hornerin 2 2
MIRT722855 NEGR1 neuronal growth regulator 1 2 2
MIRT724621 SNAP25 synaptosome associated protein 25 2 2
MIRT724777 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6819 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission