pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-449b |
Genomic Coordinates | chr5: 55170646 - 55170742 |
Description | Homo sapiens miR-449b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-449b-5p | ||||||||||||||||||
Sequence | 16| AGGCAGUGUAUUGUUAGCUGGC |37 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Microarray | DRVs in miRNA |
|
||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SSX5 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | SSX family member 5 | ||||||||||||||||||||
Transcript | NM_021015 | ||||||||||||||||||||
Other Transcripts | NM_175723 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SSX5 | |||||||||||||||||||||
3'UTR of SSX5 (miRNA target sites are highlighted) |
>SSX5|NM_021015|3'UTR 1 CTCCCCTCGGGGATATGACACATGCCCATGATGAGAAGCAGAACGTGGTGACCTTTCACGAACATGGGCATGGCTGCGGA 81 TCCCTCGTCATCAGGTGTATAGCAAGTGAAAGCAAGTGTTCACAACAGTGAAAAGTTGAGCGTCATTTTTCTTAGTGTGC 161 CAAGAGTTCGATGTTAGTGTTTCTGTTGTATTTTGTTACAGTGTGCCATTCTGTTAGATATTAGCGTTTTCACTGATGAG 241 CAAGACATACTTAATGCATATTTCAGTTTGTGTATCCATGCACCTACCTCAGAAAACAAGTATCGTCAGGTATTCTCTGC 321 ATAGAACAACACTACCCTCCTCTCTTCCCAGATGTGACCACTGAGGGCAGTTCTGAGTGTTTAATTTCAGATTTTTTCCT 401 CTGCATTTACACAAACACACACACATGCCACACAGACACACATGCGCGCGCGCGCGCACACACACACACACACACACACA 481 CACACACACACACACCAAGTACCAGTATAGGCATCTCCCAACTGCTTTTCCCCATGTGTCCTGGTCAAGCCCCCCTCACT 561 CTGTTTCCTGTTCAGCATGTACTCCCCTCATCCGATTCCCCTCTATCAGTCACTGCCAGTTAATAAACCTTTGCAAACGT 641 TAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084083 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SigmaAb |
Location of target site | ENST00000376923.1 | 3UTR | UAUCAGUCACUGCCAGUUAAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
109 hsa-miR-449b-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT006349 | SIRT1 | sirtuin 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT006350 | CCNE2 | cyclin E2 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT006351 | MET | MET proto-oncogene, receptor tyrosine kinase | ![]() |
![]() |
2 | 1 | ||||||
MIRT006352 | GMNN | geminin, DNA replication inhibitor | ![]() |
![]() |
2 | 1 | ||||||
MIRT006353 | HDAC1 | histone deacetylase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT016137 | CDK4 | cyclin dependent kinase 4 | ![]() |
1 | 1 | |||||||
MIRT016138 | CDC25A | cell division cycle 25A | ![]() |
![]() |
2 | 1 | ||||||
MIRT016139 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT057740 | ZDHHC16 | zinc finger DHHC-type containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT078636 | FAM104A | family with sequence similarity 104 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT100407 | HSPA1B | heat shock protein family A (Hsp70) member 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT115552 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT130146 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT142254 | DCTN5 | dynactin subunit 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT143724 | CCL22 | C-C motif chemokine ligand 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT168101 | E2F3 | E2F transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT169809 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT183694 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT198922 | SMAD4 | SMAD family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT202950 | TSN | translin | ![]() |
![]() |
2 | 4 | ||||||
MIRT221565 | CBX3 | chromobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT253418 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT294759 | ZNF551 | zinc finger protein 551 | ![]() |
![]() |
2 | 4 | ||||||
MIRT307053 | TGFBR2 | transforming growth factor beta receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT331273 | TM9SF3 | transmembrane 9 superfamily member 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT372293 | UBXN2B | UBX domain protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT374317 | MBD6 | methyl-CpG binding domain protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445817 | DNAAF3 | dynein axonemal assembly factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447158 | MFSD8 | major facilitator superfamily domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447823 | CTIF | cap binding complex dependent translation initiation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT448798 | GMFB | glia maturation factor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT451580 | HIRIP3 | HIRA interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452679 | GPR156 | G protein-coupled receptor 156 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453158 | CNOT4 | CCR4-NOT transcription complex subunit 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT453634 | SLC4A2 | solute carrier family 4 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455384 | PLA2G2D | phospholipase A2 group IID | ![]() |
![]() |
2 | 2 | ||||||
MIRT456958 | SPAM1 | sperm adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462739 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464321 | UST | uronyl 2-sulfotransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT465641 | TNRC18P2 | trinucleotide repeat containing 18 pseudogene 2 | ![]() |
![]() |
2 | 10 | ||||||
MIRT466748 | SYNGR2 | synaptogyrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468345 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469324 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474361 | KMT2D | lysine methyltransferase 2D | ![]() |
![]() |
2 | 2 | ||||||
MIRT475316 | IFNLR1 | interferon lambda receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477759 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477824 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478265 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT481042 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT481289 | ATXN1L | ataxin 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT482730 | COPZ1 | coatomer protein complex subunit zeta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488780 | CYTH3 | cytohesin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489578 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489659 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT490527 | KIAA1715 | lunapark, ER junction formation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT492949 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493154 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493845 | FOXN3 | forkhead box N3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494743 | ARHGAP1 | Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT496491 | MAST3 | microtubule associated serine/threonine kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503312 | FICD | FIC domain containing | ![]() |
![]() |
2 | 4 | ||||||
MIRT503507 | ZNF623 | zinc finger protein 623 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504182 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT505010 | ZNF644 | zinc finger protein 644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505352 | TMEM167A | transmembrane protein 167A | ![]() |
![]() |
2 | 2 | ||||||
MIRT505645 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT505710 | SESN2 | sestrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505777 | SATB2 | SATB homeobox 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506208 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506251 | PEG10 | paternally expressed 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507786 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT508005 | BCL2L13 | BCL2 like 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508857 | ZRSR1 | zinc finger CCCH-type, RNA binding motif and serine/arginine rich 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510546 | XBP1P1 | X-box binding protein 1 pseudogene 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT511892 | GAS1 | growth arrest specific 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512907 | UBL4A | ubiquitin like 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT513600 | VPS37B | VPS37B, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT521241 | SAR1A | secretion associated Ras related GTPase 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT521321 | RRAGD | Ras related GTP binding D | ![]() |
![]() |
2 | 4 | ||||||
MIRT525281 | C18orf32 | chromosome 18 open reading frame 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528650 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT535101 | PODXL | podocalyxin like | ![]() |
![]() |
2 | 2 | ||||||
MIRT547752 | KBTBD6 | kelch repeat and BTB domain containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547865 | HSPA13 | heat shock protein family A (Hsp70) member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549170 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550115 | SLC35G2 | solute carrier family 35 member G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556097 | MOAP1 | modulator of apoptosis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557172 | HOXA13 | homeobox A13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557422 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557931 | FAM73A | mitoguardin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568804 | VPS37D | VPS37D, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT571326 | TPCN2 | two pore segment channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572598 | PAPLN | papilin, proteoglycan like sulfated glycoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT573437 | APOPT1 | apoptogenic 1, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT574092 | VASN | vasorin | ![]() |
![]() |
2 | 2 | ||||||
MIRT608688 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT608800 | ITGA11 | integrin subunit alpha 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT610332 | SSX5 | SSX family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613158 | DDA1 | DET1 and DDB1 associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625407 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636603 | CLIC5 | chloride intracellular channel 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638573 | IER5 | immediate early response 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639686 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT677979 | ITGB3 | integrin subunit beta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685217 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT702570 | JARID2 | jumonji and AT-rich interaction domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706259 | MKLN1 | muskelin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT734675 | HMGB1 | high mobility group box 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT736369 | HSPA1A | heat shock protein family A (Hsp70) member 1A | ![]() |
1 | 0 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|