miRTarBase - #MIRT610490


—
pre-miRNA Information
pre-miRNA hsa-mir-628   
Genomic Coordinates chr15: 55372940 - 55373034
Synonyms MIRN628, hsa-mir-628, MIR628
Description Homo sapiens miR-628 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-628-3p
Sequence 61| UCUAGUAAGAGUGGCAGUCGA |81
Evidence Experimental
Experiments Microarray
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 15 - 55372968 29233923 MiREDiBase
A-to-I 8 15 - 55372967 29233923 MiREDiBase
C-to-U 19 15 - 55372956 20591823 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26969715 1 COSMIC
COSN30123186 10 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1410255602 2 dbSNP
rs1401315366 3 dbSNP
rs1322836365 4 dbSNP
rs1158103480 8 dbSNP
rs1216611749 11 dbSNP
rs749619551 13 dbSNP
rs778157225 18 dbSNP
rs756600789 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPC4   
Synonyms K-glypican
Description glypican 4
Transcript NM_001448   
Expression
Putative miRNA Targets on GPC4
3'UTR of GPC4
(miRNA target sites are highlighted)		 
>GPC4|NM_001448|3'UTR
   1 TTCTCAAACTCTGAGAAAAAGTGTTCATCAAAAAGTTAAAAGGCACCAGTTATCACTTTTCTACCATCCTAGTGACTTTG
  81 CTTTTTAAATGAATGGACAACAATGTACAGTTTTTACTATGTGGCCACTGGTTTAAGAAGTGCTGACTTTGTTTTCTCAT
 161 TCAGTTTTGGGAGGAAAAGGGACTGTGCATTGAGTTGGTTCCTGCTCCCCCAAACCATGTTAAACGTGGCTAACAGTGTA
 241 GGTACAGAACTATAGTTAGTTGTGCATTTGTGATTTTATCACTCTATTATTTGTTTGTATGTTTTTTTCTCATTTCGTTT
 321 GTGGGTTTTTTTTTCCAACTGTGATCTCGCCTTGTTTCTTACAAGCAAACCAGGGTCCCTTCTTGGCACGTAACATGTAC
 401 GTATTTCTGAAATATTAAATAGCTGTACAGAAGCAGGTTTTATTTATCATGTTATCTTATTAAAAGAAAAAGCCCAAAAA
 481 GCAGTAAAATTTCCATTTCTCCCTGTTATTTTAGTTGCCTTATCTGGAGAGACGTGGAGGTGATTTTCTTTTTTTTAAAT
 561 TATTATTAAGACAGAATGTGAGGGCACAAGCAGGCTTCTGAGCCACTTGTCAGATTGTATTCAAAGCATCAATCCAAGAA
 641 GGAGGTTATGTGTACTTCATTTATTGGTGATAGTTGGAAGAGACTGCAGACTACTGCTTTGAATGAGTTGAATTACATAA
 721 GCTAAGATCACTATAGGTCCATTTCTTGAACCCACTTATACATAAAATGTAACCCATTTAGAAAAAGATTCTGGATATCA
 801 TCCCCCTTGAAAGATAGAAAGCATTCAGGATGTCCCAGTTATCACATGTTCACACTTGGGTTTAGGGGTGTTTTTTTTTA
 881 AAACCAGGCAGGTTAGCTAGCCCACCCTGTGCTAGTTTTCATGTTCACACTGACCCTATTTGAATTAATATCCTTTGTTA
 961 GAGTGGTCGAGATTTCAAACCCAATTATGTACAGGGAGCTGTCTGAGAGCTAGCCAGAACTGGGGTACAGCCTGGGCTCA
1041 GGGAATAGCTGTCAACACTCGGGCAAAGTTTTTGTCTGTGCATGTGTATCTCCATTTGTTTTGGGATCCCAGTTTTTGTT
1121 TTAAGAGAGTATAAGGTGTCTCATTTGAGTCTTTTTCTTACCTAGCCCCCTCTTATCAGTAAAACAAAGGACTTGCCATG
1201 GTTCACAGCAATGTGCTACGATCCAAGATATCAGCCAAGGAGCCCACTTAGGGGAGAACTAGGTGTCCAGATTTTTGTAT
1281 GTGTTGTTTTTCTTGGGGGATGGGGTGGGGTGGGAGTAGGTAGAGCTGAGAATACTACATCTTAGTGGTGACCTTTAGCC
1361 ACGTGGGTGAAGTGGCAAAGGCCATGGCCATATCTGTTGTCCCAGGCCAAAGACTAACAACTGCCTTGGGAATCCCTTCC
1441 TTGTGTCCTTACCAAATGATAGCTCATAAAACTCTGATAATGTAACAAATCACTTTCAAAGGAGTTCCCAGAAGTCTTCA
1521 GAAAGACTAAAATTCTGTCTCTTCCTGCTTTAGACAGCCATTAAGATCCCAACTAATTTTACCGAACCTAAAACCCACAA
1601 AGAGGTTGTTTGTGTTATTGTTCAATCTTCAGTTGTAAGAGTAATTCTCTATTTTTATATTGAAACATAATTACTTGATA
1681 GCTCAGGGTCTACATTTCATTCAACTTTTTACACCAAATTCTGCAGAGTGGTCAAAATGGAATATTGGGGGCTGTTGTAA
1761 ACAGAGGCTTAATTTTATTAGAAGTAGCCAGTTATTTATTAAAGCATGATGTTAATAAAATAGGCATATTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agCUGACGGUGAGAAUGAUCu 5'
            |:||  :| |:|||:||| 
Target 5' gaGGCT--TAATTTTATTAGa 3'
 1764 - 1782 139.00 -10.40
2 
miRNA  3' agcUGACG-GU-GAGAAUGAUcu 5'
             | ||: || :|:||||||  
Target 5' aacAATGTACAGTTTTTACTAtg 3'
 99 - 121 134.00 -7.60
3 
miRNA  3' agCUGACGGUGAGAAU-GAUCu 5'
            || | :: :||||| |||| 
Target 5' ttGAGTCTTTTTCTTACCTAGc 3'
 1145 - 1166 127.00 -10.10
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1332914893 8 dbSNP
rs759928467 9 dbSNP
rs1180564253 16 dbSNP
rs1043120850 27 dbSNP
rs776923358 29 dbSNP
rs1175944108 31 dbSNP
rs1203629546 37 dbSNP
rs1305492329 46 dbSNP
rs771437745 47 dbSNP
rs1234875708 48 dbSNP
rs747518779 49 dbSNP
rs947041987 59 dbSNP
rs912987874 65 dbSNP
rs1428588274 80 dbSNP
rs988556724 93 dbSNP
rs190059315 103 dbSNP
rs1210388232 105 dbSNP
rs938413804 110 dbSNP
rs765935291 119 dbSNP
rs1198050003 138 dbSNP
rs1423977724 140 dbSNP
rs1478585490 145 dbSNP
rs1167821139 147 dbSNP
rs1371734981 156 dbSNP
rs1394183424 184 dbSNP
rs1191574578 189 dbSNP
rs1461742315 192 dbSNP
rs1478963232 195 dbSNP
rs980229210 202 dbSNP
rs1231175067 216 dbSNP
rs1202485704 226 dbSNP
rs1302598929 228 dbSNP
rs1341410971 247 dbSNP
rs1220716041 251 dbSNP
rs987677197 263 dbSNP
rs1293646030 266 dbSNP
rs1306707905 284 dbSNP
rs866106159 303 dbSNP
rs1482796042 306 dbSNP
rs1275467924 314 dbSNP
rs1357186345 316 dbSNP
rs760721945 317 dbSNP
rs184962419 326 dbSNP
rs1300949559 327 dbSNP
rs966438458 334 dbSNP
rs1378779338 335 dbSNP
rs201783848 335 dbSNP
rs879074072 350 dbSNP
rs1022003839 354 dbSNP
rs775152292 373 dbSNP
rs1428355035 378 dbSNP
rs1220234430 389 dbSNP
rs1387682238 395 dbSNP
rs894803130 398 dbSNP
rs772002685 400 dbSNP
rs1003442346 425 dbSNP
rs970321321 433 dbSNP
rs1287347553 445 dbSNP
rs1409773105 449 dbSNP
rs1016476818 454 dbSNP
rs985204490 468 dbSNP
rs1245191472 479 dbSNP
rs1286568442 480 dbSNP
rs1355249013 501 dbSNP
rs372905361 517 dbSNP
rs761658015 533 dbSNP
rs1309324890 534 dbSNP
rs774505603 540 dbSNP
rs1026833676 548 dbSNP
rs1182859872 553 dbSNP
rs1047610442 556 dbSNP
rs1443118568 557 dbSNP
rs929089887 557 dbSNP
rs997630151 569 dbSNP
rs868607864 573 dbSNP
rs192901084 576 dbSNP
rs901922151 577 dbSNP
rs1402581146 581 dbSNP
rs1157005459 597 dbSNP
rs759201295 599 dbSNP
rs1344871165 629 dbSNP
rs747913239 642 dbSNP
rs1466765144 646 dbSNP
rs1338900095 658 dbSNP
rs1380316683 662 dbSNP
rs1451574002 664 dbSNP
rs1176522770 669 dbSNP
rs867760854 671 dbSNP
rs749380081 697 dbSNP
rs1415996617 715 dbSNP
rs780206394 717 dbSNP
rs1221620443 723 dbSNP
rs910541586 732 dbSNP
rs1405668580 733 dbSNP
rs187722094 739 dbSNP
rs1211833820 740 dbSNP
rs1019499060 743 dbSNP
rs1006691050 752 dbSNP
rs1252545564 759 dbSNP
rs1203415854 774 dbSNP
rs183712688 775 dbSNP
rs1484806014 782 dbSNP
rs889711392 786 dbSNP
rs1471424063 792 dbSNP
rs1255696786 794 dbSNP
rs1175606094 801 dbSNP
rs1407391860 822 dbSNP
rs1433780339 826 dbSNP
rs574860294 835 dbSNP
rs1404170156 846 dbSNP
rs924830290 854 dbSNP
rs977560219 860 dbSNP
rs768387427 861 dbSNP
rs1439967029 868 dbSNP
rs968911495 870 dbSNP
rs1367697336 872 dbSNP
rs868678365 879 dbSNP
rs1022497909 880 dbSNP
rs1223321520 880 dbSNP
rs374672159 880 dbSNP
rs771321471 884 dbSNP
rs1228248268 885 dbSNP
rs113785847 893 dbSNP
rs1488880431 897 dbSNP
rs1201676767 905 dbSNP
rs1289668354 910 dbSNP
rs1033371072 911 dbSNP
rs1427507842 913 dbSNP
rs1412460663 953 dbSNP
rs1171586472 958 dbSNP
rs749814987 968 dbSNP
rs1407941000 969 dbSNP
rs980242047 972 dbSNP
rs139478218 984 dbSNP
rs1406316795 992 dbSNP
rs1300713017 1001 dbSNP
rs1344530713 1004 dbSNP
rs756177899 1006 dbSNP
rs1400251683 1024 dbSNP
rs1271506825 1025 dbSNP
rs754680730 1026 dbSNP
rs948855452 1032 dbSNP
rs1273002137 1047 dbSNP
rs1458411041 1050 dbSNP
rs1360753567 1060 dbSNP
rs1224877492 1075 dbSNP
rs909466909 1082 dbSNP
rs985035385 1101 dbSNP
rs1194668286 1103 dbSNP
rs951021507 1106 dbSNP
rs753388823 1123 dbSNP
rs1026197078 1125 dbSNP
rs993371910 1133 dbSNP
rs1414499199 1142 dbSNP
rs898992656 1147 dbSNP
rs1161546285 1151 dbSNP
rs1364444809 1161 dbSNP
rs1419712548 1176 dbSNP
rs1038221879 1180 dbSNP
rs765988373 1202 dbSNP
rs943449907 1207 dbSNP
rs1429109161 1218 dbSNP
rs1269952766 1219 dbSNP
rs770016908 1228 dbSNP
rs966120384 1229 dbSNP
rs1017670103 1231 dbSNP
rs1290142247 1246 dbSNP
rs1358838973 1259 dbSNP
rs1457647527 1260 dbSNP
rs1286696576 1262 dbSNP
rs1445467188 1307 dbSNP
rs889168598 1309 dbSNP
rs1192269062 1315 dbSNP
rs1237864628 1315 dbSNP
rs1414165794 1320 dbSNP
rs1006743462 1325 dbSNP
rs1051721781 1331 dbSNP
rs1384518978 1337 dbSNP
rs1419847581 1340 dbSNP
rs933281637 1345 dbSNP
rs1161458248 1362 dbSNP
rs1422188004 1374 dbSNP
rs953881317 1376 dbSNP
rs1334352348 1381 dbSNP
rs1407299808 1402 dbSNP
rs1182628140 1412 dbSNP
rs191323140 1414 dbSNP
rs1454866878 1425 dbSNP
rs1313633511 1453 dbSNP
rs1382693672 1459 dbSNP
rs150900762 1466 dbSNP
rs1281332276 1469 dbSNP
rs1348569600 1477 dbSNP
rs1041943917 1478 dbSNP
rs748200297 1483 dbSNP
rs1263916353 1486 dbSNP
rs1240668256 1491 dbSNP
rs77746685 1497 dbSNP
rs947570961 1504 dbSNP
rs1201530185 1506 dbSNP
rs1242496276 1507 dbSNP
rs1011519976 1513 dbSNP
rs914726930 1516 dbSNP
rs992042740 1525 dbSNP
rs959166731 1540 dbSNP
rs926328074 1549 dbSNP
rs1469118400 1553 dbSNP
rs891697791 1555 dbSNP
rs981776965 1560 dbSNP
rs1430962438 1567 dbSNP
rs111937817 1582 dbSNP
rs1026271822 1583 dbSNP
rs1270622741 1584 dbSNP
rs1406060419 1590 dbSNP
rs1392503718 1600 dbSNP
rs374996632 1604 dbSNP
rs1334061990 1611 dbSNP
rs1238404924 1612 dbSNP
rs781301670 1617 dbSNP
rs1016119217 1625 dbSNP
rs774178648 1635 dbSNP
rs948918010 1638 dbSNP
rs1480812228 1639 dbSNP
rs1197485832 1645 dbSNP
rs909405405 1660 dbSNP
rs1436783792 1693 dbSNP
rs755205774 1704 dbSNP
rs1229608365 1716 dbSNP
rs1359443202 1724 dbSNP
rs889207148 1735 dbSNP
rs1175206177 1745 dbSNP
rs1462756082 1754 dbSNP
rs1170162783 1757 dbSNP
rs1319626218 1764 dbSNP
rs1049687673 1766 dbSNP
rs1303813283 1781 dbSNP
rs571896728 1826 dbSNP
rs997506371 1850 dbSNP
rs5975390 1851 dbSNP
rs201175806 1852 dbSNP
rs41300203 1859 dbSNP
rs769877473 1861 dbSNP
rs1222652592 1862 dbSNP
rs1338635532 1862 dbSNP
rs183232864 1862 dbSNP
rs1165591198 1863 dbSNP
rs41299096 1865 dbSNP
rs1388626390 1866 dbSNP
rs929614684 1879 dbSNP
rs1429550406 1881 dbSNP
rs919464356 1884 dbSNP
rs1371898315 1892 dbSNP
rs1188296405 1893 dbSNP
rs771445820 1896 dbSNP
rs200087683 1898 dbSNP
rs926400163 1899 dbSNP
rs1422755348 1906 dbSNP
rs981852274 1909 dbSNP
rs2239463 1910 dbSNP
rs1293153941 1914 dbSNP
rs1325590728 1921 dbSNP
rs1246665759 1927 dbSNP
rs1488441380 1935 dbSNP
rs763977021 1951 dbSNP
rs1265454699 1982 dbSNP
rs966008402 1993 dbSNP
rs1305397701 2002 dbSNP
rs1456028319 2023 dbSNP
rs1296466238 2033 dbSNP
rs972118862 2040 dbSNP
rs1260986435 2050 dbSNP
rs1486630554 2051 dbSNP
rs963332806 2052 dbSNP
rs758619409 2053 dbSNP
rs1449170107 2061 dbSNP
rs1184761892 2063 dbSNP
rs1016553262 2078 dbSNP
rs1228712237 2088 dbSNP
rs1007431145 2150 dbSNP
rs1164139847 2152 dbSNP
rs1367044208 2153 dbSNP
rs1300990352 2158 dbSNP
rs1455563193 2162 dbSNP
rs1287294321 2184 dbSNP
rs953205490 2207 dbSNP
rs1387643729 2212 dbSNP
rs910660659 2215 dbSNP
rs1317146957 2218 dbSNP
rs765389886 2224 dbSNP
rs1244669810 2227 dbSNP
rs1307109966 2230 dbSNP
rs1030401220 2248 dbSNP
rs1318155109 2251 dbSNP
rs1213215677 2253 dbSNP
rs1259719969 2256 dbSNP
rs986239889 2278 dbSNP
rs1204702190 2287 dbSNP
rs142828571 2288 dbSNP
rs903253034 2298 dbSNP
rs1021490352 2300 dbSNP
rs779837183 2302 dbSNP
rs1420890348 2303 dbSNP
rs1157215579 2315 dbSNP
rs1411491790 2320 dbSNP
rs1470187283 2322 dbSNP
rs1338430209 2329 dbSNP
rs1403570758 2332 dbSNP
rs1368927072 2337 dbSNP
rs1011958723 2341 dbSNP
rs893391333 2358 dbSNP
rs1298610006 2364 dbSNP
rs955983344 2370 dbSNP
rs755754409 2371 dbSNP
rs1221556829 2372 dbSNP
rs1056448352 2379 dbSNP
rs1002506372 2385 dbSNP
rs906854499 2402 dbSNP
rs756012672 2436 dbSNP
rs1265415524 2447 dbSNP
rs1460231457 2457 dbSNP
rs749925225 2471 dbSNP
rs767615618 2483 dbSNP
rs191582179 2485 dbSNP
rs887521111 2486 dbSNP
rs1251421780 2487 dbSNP
rs1480899390 2494 dbSNP
rs1433098267 2495 dbSNP
rs6638075 2513 dbSNP
rs949136128 2529 dbSNP
rs918982986 2550 dbSNP
rs1413636974 2553 dbSNP
rs971757003 2558 dbSNP
rs1356199092 2564 dbSNP
rs929431681 2566 dbSNP
rs1306854521 2568 dbSNP
rs1345547205 2587 dbSNP
rs941686631 2591 dbSNP
rs1280902825 2598 dbSNP
rs763955252 2605 dbSNP
rs1274406826 2612 dbSNP
rs1309750237 2621 dbSNP
rs1273326357 2628 dbSNP
rs1205347292 2635 dbSNP
rs752249310 2641 dbSNP
rs41311664 2642 dbSNP
rs759177052 2649 dbSNP
rs535229514 2651 dbSNP
rs570421065 2652 dbSNP
rs1477612237 2659 dbSNP
rs1186855652 2678 dbSNP
rs1421631834 2678 dbSNP
rs975859294 2681 dbSNP
rs967444156 2700 dbSNP
rs765411863 2702 dbSNP
rs1389632493 2703 dbSNP
rs1365668648 2710 dbSNP
rs986527665 2715 dbSNP
rs1300972138 2721 dbSNP
rs1011618116 2723 dbSNP
rs1436259224 2730 dbSNP
rs1271160488 2731 dbSNP
rs1364473094 2749 dbSNP
rs893119232 2752 dbSNP
rs1226842561 2763 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084067
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SantaCruzAb
Location of target site ENST00000370828.3 | 3UTR | AGGAGGGUGUGUGUGUGUGUGUGUGCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUGCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUGCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000370828.3 | 3UTR | AGGAGGGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1084076
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000370828.3 | 3UTR | AGGAGGGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | UAGAGGAGGGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000370828.3 | 3UTR | AGAGGAGGGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.805 4.5e-4 -0.648 8.3e-3 13 Click to see details
GSE28544 Breast cancer 0.579 1.5e-3 0.563 2.1e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.398 4.1e-2 0.477 1.7e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.354 4.1e-2 0.481 7.5e-3 25 Click to see details
GSE27834 Pluripotent stem cells -0.424 5.1e-2 -0.412 5.6e-2 16 Click to see details
GSE38226 Liver fibrosis -0.36 5.4e-2 -0.347 6.2e-2 21 Click to see details
GSE21687 Ependynoma primary tumors -0.197 5.9e-2 -0.120 1.7e-1 64 Click to see details
GSE32688 Pancreatic cancer -0.272 6.6e-2 -0.185 1.6e-1 32 Click to see details
GSE19536 Breast cancer 0.146 7.4e-2 0.196 2.5e-2 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.328 7.9e-2 -0.392 4.4e-2 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.291 8.9e-2 -0.243 1.3e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.123 1.2e-1 0.193 3.4e-2 90 Click to see details
GSE17306 Multiple myeloma 0.147 1.6e-1 0.137 1.7e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.174 2.1e-1 -0.168 2.2e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.247 2.2e-1 -0.238 2.3e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.082 2.4e-1 0.148 9.7e-2 79 Click to see details
GSE17498 Multiple myeloma -0.045 3.9e-1 -0.090 2.9e-1 40 Click to see details
GSE21849 B cell lymphoma 0.048 4.0e-1 0.443 8.0e-3 29 Click to see details
GSE21849 B cell lymphoma 0.048 4.0e-1 0.443 8.0e-3 29 Click to see details
GSE21849 B cell lymphoma 0.048 4.0e-1 0.443 8.0e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.505 0 -0.499 0 28 Click to see details
LUAD -0.54 0.05 -0.479 0.08 10 Click to see details
KICH -0.336 0.06 -0.294 0.09 22 Click to see details
KIRC -0.228 0.08 -0.064 0.35 40 Click to see details
LUSC 0.219 0.1 0.263 0.06 35 Click to see details
HNSC 0.207 0.12 0.084 0.32 35 Click to see details
LIHC -0.154 0.15 -0.234 0.05 49 Click to see details
CHOL -0.452 0.15 -0.107 0.41 7 Click to see details
PAAD -0.681 0.16 -0.400 0.3 4 Click to see details
UCEC -0.248 0.16 -0.280 0.13 18 Click to see details
PRAD 0.109 0.26 0.027 0.44 36 Click to see details
KIRP -0.118 0.27 -0.189 0.16 29 Click to see details
CESC 0.596 0.3 0.500 0.33 3 Click to see details
ESCA -0.164 0.31 -0.209 0.27 11 Click to see details
BLCA -0.075 0.39 -0.225 0.19 17 Click to see details
BRCA -0.039 0.41 -0.055 0.38 34 Click to see details
THCA -0.028 0.42 0.043 0.37 58 Click to see details
PCPG 0.202 0.44 0.500 0.33 3 Click to see details
PCPG 0.202 0.44 0.500 0.33 3 Click to see details
27 hsa-miR-628-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039584 CDC14A cell division cycle 14A 1 1
MIRT039585 AGO1 argonaute 1, RISC catalytic component 2 3
MIRT039586 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT039587 LRP6 LDL receptor related protein 6 1 1
MIRT071876 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT097443 JMY junction mediating and regulatory protein, p53 cofactor 2 4
MIRT100100 ABT1 activator of basal transcription 1 2 8
MIRT147692 CBX4 chromobox 4 2 2
MIRT408248 PURA purine rich element binding protein A 2 2
MIRT442047 LRAT lecithin retinol acyltransferase 2 2
MIRT444412 RAB3IP RAB3A interacting protein 2 2
MIRT452599 REPIN1 replication initiator 1 2 2
MIRT469515 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT498192 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT500151 CREBBP CREB binding protein 2 2
MIRT507319 FAM60A SIN3-HDAC complex associated factor 2 6
MIRT508343 ZNF273 zinc finger protein 273 2 6
MIRT520480 TRIM13 tripartite motif containing 13 2 2
MIRT522461 MMP16 matrix metallopeptidase 16 2 4
MIRT547116 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT548675 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT553756 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT559437 ARSJ arylsulfatase family member J 2 2
MIRT610490 GPC4 glypican 4 2 2
MIRT644682 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT658214 FBXO21 F-box protein 21 2 2
MIRT756083 TP53 tumor protein p53 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-628 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-628-3p Erlotinib 176870 NSC718781 approved sensitive High Epithelial Cancer cell line (A549, UKY-29, H460, H1975, H1650, H3255, PC-9, H358)
hsa-miR-628-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-628-3p Sunitinib 5329102 NSC750690 approved resistant High Metastatic Renal Cell Carcinoma tissue and cell line (Caki-2)
hsa-miR-628-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-628-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-628-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (TAMR8)
hsa-miR-628-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-628-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-628-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-628-3p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-628-3p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer cell line (CDDP-R-BOY, CDDP-R-T24)
hsa-miR-628-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-628-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-628-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-628-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-628-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-628-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-628-3p Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission