>BARHL2|NM_020063|3'UTR
   1 AAACATTGCAGCGAAGGCACTGCAATCCCTTCCCCATATCCCTGCCCAACCCGGACTGCTGCCCGTCCTCTCCCTGCTCC
  81 AGGCCACTAGGCCTCCCTTGCAGCCAACTCTGGAAGGCAGAGGAGTAAGAGAGGAAGATGCTTACCAGTGGGCAGGGGAC
 161 CCCCAAAGAGGAGCCAGCCCTCTGCTCTCCATCTCCCCACCCCTAGAAACAGGGCTGGAAATCTCCCCCACAGCAGTGTG
 241 ACTGGTGAAAATGCTGACCCCACACAGAGTGCAACCAGTAAGTGAAAACA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaUACC--CACC-CUGUCUCUCCc 5' | || | || | ||||||| Target 5' ggAAGGCAGAGGAGTAAGAGAGGa 3'	112 - 135	145.00	-13.90
2	miRNA 3' gaUACCC--ACCCU----GUCUCUCCc 5' :|||| |||| || ||||| Target 5' caGTGGGCAGGGGACCCCCAAAGAGGa 3'	146 - 172	127.00	-19.90
3	miRNA 3' gauacccacccUGUCUCUCcc 5' ||| |||| Target 5' atgctgaccccACACAGAGtg 3'	251 - 271	98.00	-8.66

Mutant ID	Mutant Position	Mutant Source
COSN30162195	84	COSMIC
COSN31580852	151	COSMIC
COSN22723041	211	COSMIC
COSN6050080	212	COSMIC
COSN6050079	213	COSMIC
COSN25080498	356	COSMIC
COSN1463120	653	COSMIC
COSN23484767	730	COSMIC
COSN29796606	761	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1454387259	4	dbSNP
rs190029175	5	dbSNP
rs914163697	6	dbSNP
rs1242165646	10	dbSNP
rs572350932	12	dbSNP
rs1293701503	16	dbSNP
rs961155406	19	dbSNP
rs1217743522	22	dbSNP
rs754246199	35	dbSNP
rs1466066287	36	dbSNP
rs372034213	37	dbSNP
rs1382709542	39	dbSNP
rs1271419860	40	dbSNP
rs1490738908	41	dbSNP
rs1013009113	44	dbSNP
rs1292958452	50	dbSNP
rs371381754	51	dbSNP
rs1002351437	52	dbSNP
rs951844898	53	dbSNP
rs1418959346	58	dbSNP
rs1027712014	61	dbSNP
rs1367161131	62	dbSNP
rs553900024	64	dbSNP
rs538764333	65	dbSNP
rs1454547391	68	dbSNP
rs897713112	70	dbSNP
rs1406140076	72	dbSNP
rs1297154729	73	dbSNP
rs1374193843	86	dbSNP
rs571687484	87	dbSNP
rs901511709	91	dbSNP
rs528154082	107	dbSNP
rs1247271414	109	dbSNP
rs1355981445	116	dbSNP
rs538272678	122	dbSNP
rs1008809887	125	dbSNP
rs751554631	134	dbSNP
rs943147126	134	dbSNP
rs888929178	138	dbSNP
rs1050286256	139	dbSNP
rs1245739290	146	dbSNP
rs910689512	164	dbSNP
rs1054615899	165	dbSNP
rs1178445044	165	dbSNP
rs1185923508	166	dbSNP
rs932705165	177	dbSNP
rs903939407	178	dbSNP
rs1043712665	180	dbSNP
rs567655959	197	dbSNP
rs945349600	198	dbSNP
rs913941505	201	dbSNP
rs1422478430	209	dbSNP
rs1164425164	210	dbSNP
rs924863223	212	dbSNP
rs977645588	221	dbSNP
rs2390606	222	dbSNP
rs1175624188	228	dbSNP
rs917268422	230	dbSNP
rs939650294	231	dbSNP
rs926757939	246	dbSNP
rs1454008108	248	dbSNP
rs7538780	252	dbSNP
rs559600022	255	dbSNP
rs951847875	256	dbSNP
rs1381096401	257	dbSNP
rs1228104462	258	dbSNP
rs1027368788	268	dbSNP
rs1358417699	277	dbSNP
rs1307721452	303	dbSNP
rs1017464397	308	dbSNP
rs1006051025	310	dbSNP
rs1456912014	317	dbSNP
rs532698487	331	dbSNP
rs951899526	342	dbSNP
rs902653316	345	dbSNP
rs1305666033	347	dbSNP
rs1389104639	348	dbSNP
rs1374890625	351	dbSNP
rs1298345875	355	dbSNP
rs1018588525	356	dbSNP
rs1181085007	356	dbSNP
rs1008739712	357	dbSNP
rs1399711496	359	dbSNP
rs532127462	361	dbSNP
rs1040060746	362	dbSNP
rs1447857670	362	dbSNP
rs1425843274	363	dbSNP
rs1271169706	364	dbSNP
rs1364462109	370	dbSNP
rs565017743	374	dbSNP
rs372439576	379	dbSNP
rs1000039509	381	dbSNP
rs904387130	382	dbSNP
rs1264393550	384	dbSNP
rs543133632	385	dbSNP
rs192549780	386	dbSNP
rs560543021	387	dbSNP
rs1242514814	390	dbSNP
rs936130136	394	dbSNP
rs750311500	395	dbSNP
rs778971016	396	dbSNP
rs892456726	398	dbSNP
rs1056494856	400	dbSNP
rs1178684747	406	dbSNP
rs915396	407	dbSNP
rs1414421914	415	dbSNP
rs572363161	421	dbSNP
rs1347354400	427	dbSNP
rs1429052932	427	dbSNP
rs917511531	429	dbSNP
rs1339457159	435	dbSNP
rs1223679391	436	dbSNP
rs926899974	439	dbSNP
rs1356789282	440	dbSNP
rs1318925315	451	dbSNP
rs981316429	455	dbSNP
rs930820620	456	dbSNP
rs920802354	459	dbSNP
rs971769715	462	dbSNP
rs554095480	466	dbSNP
rs1018541014	468	dbSNP
rs753245834	472	dbSNP
rs1262131407	473	dbSNP
rs1490583763	478	dbSNP
rs909965872	481	dbSNP
rs1376043045	484	dbSNP
rs984207852	488	dbSNP
rs1159717811	489	dbSNP
rs1410781283	490	dbSNP
rs1418344336	492	dbSNP
rs1158418903	493	dbSNP
rs1288472295	497	dbSNP
rs987157100	498	dbSNP
rs1405208120	503	dbSNP
rs1343314247	504	dbSNP
rs1328893866	508	dbSNP
rs539250498	511	dbSNP
rs574899894	512	dbSNP
rs376728580	517	dbSNP
rs1028901349	524	dbSNP
rs1000559086	525	dbSNP
rs763680168	526	dbSNP
rs1384729087	531	dbSNP
rs1285070588	532	dbSNP
rs1359855891	537	dbSNP
rs1225054205	538	dbSNP
rs904335977	541	dbSNP
rs1455847063	576	dbSNP
rs965972304	578	dbSNP
rs1364438493	591	dbSNP
rs1175869888	593	dbSNP
rs578099098	595	dbSNP
rs1009628773	596	dbSNP
rs1431632814	598	dbSNP
rs892575095	603	dbSNP
rs1056440643	608	dbSNP
rs1426914914	613	dbSNP
rs1003555677	615	dbSNP
rs1451914650	615	dbSNP
rs1260813273	616	dbSNP
rs905227721	621	dbSNP
rs187599252	624	dbSNP
rs1032686944	630	dbSNP
rs769460418	639	dbSNP
rs1444535807	641	dbSNP
rs930914754	642	dbSNP
rs1246695031	646	dbSNP
rs201356817	646	dbSNP
rs920750685	650	dbSNP
rs1036506975	651	dbSNP
rs940405258	664	dbSNP
rs911648872	682	dbSNP
rs1178613108	687	dbSNP
rs1244292286	688	dbSNP
rs185565149	694	dbSNP
rs1284752634	696	dbSNP
rs987660429	699	dbSNP
rs953070119	705	dbSNP
rs1401892834	706	dbSNP
rs896062612	707	dbSNP
rs1316749899	714	dbSNP
rs1056490638	718	dbSNP
rs1406746984	720	dbSNP
rs149503623	731	dbSNP
rs536532928	731	dbSNP
rs1339604030	736	dbSNP
rs1228499940	742	dbSNP
rs978685972	743	dbSNP
rs368876154	751	dbSNP
rs1316217682	757	dbSNP
rs1198075484	759	dbSNP
rs1263774508	762	dbSNP
rs1384407324	763	dbSNP
rs553823594	769	dbSNP
rs968633301	769	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.

- Molecular cell, 2017

MicroRNA-122, an abundant and conserved liver-specific miRNA, regulates hepatic metabolism and functions as a tumor suppressor, yet systematic and direct biochemical elucidation of the miR-122 target network remains incomplete. To this end, we performed Argonaute crosslinking immunoprecipitation (Argonaute [Ago]-CLIP) sequencing in miR-122 knockout and control mouse livers, as well as in matched human hepatocellular carcinoma (HCC) and benign liver tissue to identify miRNA target sites transcriptome-wide in two species. We observed a majority of miR-122 binding on 3' UTRs and coding exons followed by extensive binding to other genic and non-genic sites. Motif analysis of miR-122-dependent binding revealed a G-bulged motif in addition to canonical motifs. A large number of miR-122 targets were found to be species specific. Upregulation of several common mouse and human targets, most notably BCL9, predicted survival in HCC patients. These results broadly define the molecular consequences of miR-122 downregulation in hepatocellular carcinoma.