miRTarBase - #MIRT610832


—
pre-miRNA Information
pre-miRNA hsa-mir-215   
Genomic Coordinates chr1: 220117853 - 220117962
Synonyms MIRN215, miRNA215, mir-215, MIR215
Description Homo sapiens miR-215 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-215-3p
Sequence 64| UCUGUCAUUUCUUUAGGCCAAUA |86
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs768393822 2 dbSNP
rs1345487830 5 dbSNP
rs757646667 7 dbSNP
rs754286532 11 dbSNP
rs749489380 17 dbSNP
rs1333471638 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COL9A1   
Synonyms DJ149L1.1.2, EDM6, MED, STL4
Description collagen type IX alpha 1 chain
Transcript NM_001851   
Other Transcripts NM_078485   
Expression
Putative miRNA Targets on COL9A1
3'UTR of COL9A1
(miRNA target sites are highlighted)		 
>COL9A1|NM_001851|3'UTR
   1 AAGGCTTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGG
  81 GCAAAGATGATTACCTTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATAT
 161 AGAAGAACGGTGCTATTCAGTAAGTTCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAA
 241 AAGAAAACCAAACACCTCCCTTGAATAAATTTATACTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTG
 321 TCTTATCGTGGGCCACTGTGCCAATAAACAAAAACAACTGTTTGGTTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAA
 401 GTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGACTAGTTATGAAGAAACCCCACTACATTCAATGGAAT
 481 TGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTACATCTCCCGAAATGATTTCTTTACGTC
 561 ATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTGTTAATATTTTGAGCGC
 641 TTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTAAAGGTT
 721 TGAGGTAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCA
 801 TGTTCAATGAAAAGAAGTTACTGAGCTTATTTAGATACATTAAACATTACTTAACTAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auAACCGGAUUUCUUUACUGUCu 5'
            ||  |:|::||::| ||||| 
Target 5' ctTTCCCTTGGAGGGAAGACAGc 3'
 194 - 216 137.00 -14.70
2 
miRNA  3' auAACCGGAUUUCU-UUACUGUCu 5'
            ||  |:| |: | :|| |||| 
Target 5' taTTACCTTCAGTATGATTACAGa 3'
 114 - 137 121.00 -10.50
3 
miRNA  3' auaaCCGGAUUU------CUUUACUGucu 5'
              || ||| |      |||||||:   
Target 5' gaaaGGGCTACATCTCCCGAAATGATttc 3'
 524 - 552 105.00 -8.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
357795 174 ClinVar
1189526 243 ClinVar
357793 243 ClinVar
357792 248 ClinVar
COSN30193671 4 COSMIC
COSN30190385 51 COSMIC
COSN24301763 53 COSMIC
COSN30487137 56 COSMIC
COSN30573277 78 COSMIC
COSN30528421 102 COSMIC
COSN27746275 103 COSMIC
COSN30143985 126 COSMIC
COSN31591295 152 COSMIC
COSN31607216 207 COSMIC
COSN27459296 229 COSMIC
COSN27236032 230 COSMIC
COSN24343785 242 COSMIC
COSN28683820 243 COSMIC
COSN19656594 266 COSMIC
COSN26586372 298 COSMIC
COSN31568466 332 COSMIC
COSN26552041 392 COSMIC
COSN31527907 424 COSMIC
COSN31517068 500 COSMIC
COSN22659906 521 COSMIC
COSN31778514 542 COSMIC
COSN31579595 570 COSMIC
COSN2174971 599 COSMIC
COSN31597421 603 COSMIC
COSN31534688 687 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1458489153 8 dbSNP
rs778177942 12 dbSNP
rs1165011056 20 dbSNP
rs755948864 25 dbSNP
rs779371541 27 dbSNP
rs371413126 28 dbSNP
rs886061695 33 dbSNP
rs6923452 36 dbSNP
rs535973057 37 dbSNP
rs759522163 38 dbSNP
rs1257048405 40 dbSNP
rs928180257 42 dbSNP
rs750975498 46 dbSNP
rs373931410 48 dbSNP
rs1361950697 51 dbSNP
rs1221606818 52 dbSNP
rs1045330188 55 dbSNP
rs1184503372 66 dbSNP
rs1261306353 77 dbSNP
rs1424612487 81 dbSNP
rs373398023 89 dbSNP
rs1189778900 94 dbSNP
rs1383438660 101 dbSNP
rs1444604816 105 dbSNP
rs1159808577 110 dbSNP
rs948228382 110 dbSNP
rs1433198294 115 dbSNP
rs1397291451 124 dbSNP
rs998334424 127 dbSNP
rs1288649228 132 dbSNP
rs1383861806 134 dbSNP
rs896856867 135 dbSNP
rs1396226769 146 dbSNP
rs1316582199 147 dbSNP
rs1379985951 154 dbSNP
rs567006253 157 dbSNP
rs1309906601 160 dbSNP
rs1318586070 161 dbSNP
rs1213466191 164 dbSNP
rs759272502 165 dbSNP
rs1205773967 168 dbSNP
rs1483730056 168 dbSNP
rs1194671642 169 dbSNP
rs776515044 174 dbSNP
rs1179260492 184 dbSNP
rs923968939 187 dbSNP
rs770787617 196 dbSNP
rs1158897975 200 dbSNP
rs1198683468 200 dbSNP
rs1378538671 206 dbSNP
rs1467861661 208 dbSNP
rs1338324817 213 dbSNP
rs1403376889 220 dbSNP
rs1486496692 225 dbSNP
rs1280782930 226 dbSNP
rs1227473697 227 dbSNP
rs1341703283 228 dbSNP
rs2459555 229 dbSNP
rs987854679 232 dbSNP
rs1054980931 240 dbSNP
rs1229655914 241 dbSNP
rs796116774 241 dbSNP
rs201244576 243 dbSNP
rs3215859 243 dbSNP
rs555755721 243 dbSNP
rs879223907 243 dbSNP
rs1199413450 244 dbSNP
rs1327128383 246 dbSNP
rs1234648994 248 dbSNP
rs1334022640 248 dbSNP
rs886061694 248 dbSNP
rs937880910 255 dbSNP
rs954663055 256 dbSNP
rs1177164174 260 dbSNP
rs1029353028 264 dbSNP
rs1064250 266 dbSNP
rs963219651 278 dbSNP
rs1426853914 295 dbSNP
rs1468956958 305 dbSNP
rs1170596160 320 dbSNP
rs981585946 322 dbSNP
rs1016042100 327 dbSNP
rs1439346085 343 dbSNP
rs565189871 360 dbSNP
rs191406921 365 dbSNP
rs886147241 365 dbSNP
rs1323154770 371 dbSNP
rs531745614 375 dbSNP
rs771960432 380 dbSNP
rs1035377565 384 dbSNP
rs913240158 396 dbSNP
rs1416912818 401 dbSNP
rs186882898 412 dbSNP
rs957631444 413 dbSNP
rs1203840720 417 dbSNP
rs1266555751 418 dbSNP
rs1339421252 423 dbSNP
rs749364459 425 dbSNP
rs1197789552 428 dbSNP
rs1045382813 429 dbSNP
rs751855141 429 dbSNP
rs1185236607 430 dbSNP
rs1476143814 441 dbSNP
rs1258206851 442 dbSNP
rs986098645 444 dbSNP
rs1169128560 463 dbSNP
rs1366175398 468 dbSNP
rs780122438 474 dbSNP
rs1301102700 479 dbSNP
rs1344667707 480 dbSNP
rs1204147453 499 dbSNP
rs375176049 503 dbSNP
rs1400325180 505 dbSNP
rs948278820 508 dbSNP
rs954267664 521 dbSNP
rs570034842 530 dbSNP
rs55709776 538 dbSNP
rs191432958 541 dbSNP
rs1271464622 542 dbSNP
rs560557089 550 dbSNP
rs1340078049 555 dbSNP
rs896874312 557 dbSNP
rs373018250 558 dbSNP
rs1291640762 561 dbSNP
rs1488835029 567 dbSNP
rs1357896929 574 dbSNP
rs1243556842 578 dbSNP
rs1474213838 580 dbSNP
rs1385276091 589 dbSNP
rs987560731 589 dbSNP
rs1445877265 594 dbSNP
rs551683531 599 dbSNP
rs1364820894 616 dbSNP
rs1401083996 621 dbSNP
rs1409554584 622 dbSNP
rs1320043655 637 dbSNP
rs1005195803 638 dbSNP
rs921934112 639 dbSNP
rs746120474 646 dbSNP
rs1410183337 653 dbSNP
rs1389651425 654 dbSNP
rs1225891029 657 dbSNP
rs974664294 658 dbSNP
rs1444962741 660 dbSNP
rs1055074480 662 dbSNP
rs963229450 675 dbSNP
rs1243318759 678 dbSNP
rs1462274644 683 dbSNP
rs1462605020 684 dbSNP
rs1384608326 685 dbSNP
rs937919022 687 dbSNP
rs1160138851 688 dbSNP
rs1405483558 690 dbSNP
rs1181396673 695 dbSNP
rs1468358614 713 dbSNP
rs906407856 714 dbSNP
rs1450625364 724 dbSNP
rs1016051825 726 dbSNP
rs1046618779 729 dbSNP
rs950173474 735 dbSNP
rs1234400040 740 dbSNP
rs913290840 743 dbSNP
rs1241763765 750 dbSNP
rs1278249752 751 dbSNP
rs1182340631 752 dbSNP
rs1220114862 761 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084040
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep1
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AGAUGCGUAUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084075
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb
Location of target site ENST00000357250.6 | 3UTR | AGAUGCGUAUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084076
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000357250.6 | 3UTR | AGAUGCGUAUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000357250.6 | 3UTR | AUGCGUAUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
96 hsa-miR-215-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058509 TEAD1 TEA domain transcription factor 1 2 2
MIRT445625 TMEM50A transmembrane protein 50A 2 2
MIRT449286 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT456702 LDB1 LIM domain binding 1 2 2
MIRT467723 SLC38A1 solute carrier family 38 member 1 2 2
MIRT474253 LATS2 large tumor suppressor kinase 2 2 2
MIRT481811 AP4E1 adaptor related protein complex 4 epsilon 1 subunit 2 2
MIRT491969 USP37 ubiquitin specific peptidase 37 2 2
MIRT513203 RFT1 RFT1 homolog 2 2
MIRT532737 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT535706 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT536138 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT536463 KLF12 Kruppel like factor 12 2 4
MIRT552615 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554011 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT563259 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT571054 POLQ DNA polymerase theta 2 4
MIRT573556 TMEM120B transmembrane protein 120B 2 2
MIRT573772 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT575328 Fbxo6 F-box protein 6 2 2
MIRT575497 Sept3 septin 3 2 5
MIRT607051 IDS iduronate 2-sulfatase 2 2
MIRT607070 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607497 HEBP2 heme binding protein 2 2 2
MIRT607799 RHBDL2 rhomboid like 2 2 2
MIRT610832 COL9A1 collagen type IX alpha 1 chain 2 2
MIRT616853 DSG2 desmoglein 2 2 2
MIRT617154 C18orf42 A-kinase anchor inhibitor 1 2 2
MIRT620823 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT625698 OPTN optineurin 2 2
MIRT628082 KAT7 lysine acetyltransferase 7 2 2
MIRT633540 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634343 SGOL1 shugoshin 1 2 2
MIRT634605 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT636759 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637044 SEPT3 septin 3 2 7
MIRT637213 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT639634 ZSCAN23 zinc finger and SCAN domain containing 23 2 2
MIRT640818 GPR107 G protein-coupled receptor 107 2 2
MIRT641033 PITPNB phosphatidylinositol transfer protein beta 2 2
MIRT641545 MOCOS molybdenum cofactor sulfurase 2 2
MIRT642091 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT645528 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647017 ADCY2 adenylate cyclase 2 2 2
MIRT648044 FADS6 fatty acid desaturase 6 2 2
MIRT648514 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648869 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT656722 LMLN leishmanolysin like peptidase 2 2
MIRT658260 FAXC failed axon connections homolog 2 2
MIRT659063 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT659364 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT660318 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663345 ZNF74 zinc finger protein 74 2 2
MIRT663526 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663975 ZNF786 zinc finger protein 786 2 2
MIRT664354 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664473 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664975 TDRD1 tudor domain containing 1 2 2
MIRT665488 VPS53 VPS53, GARP complex subunit 2 2
MIRT667758 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669552 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT670183 CCDC142 coiled-coil domain containing 142 2 2
MIRT671342 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671873 ZNF429 zinc finger protein 429 2 2
MIRT672018 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672068 KIAA0930 KIAA0930 2 2
MIRT672551 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT672849 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672988 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673088 AK1 adenylate kinase 1 2 2
MIRT673578 KDELC2 KDEL motif containing 2 2 2
MIRT674582 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674999 STRN3 striatin 3 2 2
MIRT675596 ZNF106 zinc finger protein 106 2 2
MIRT675778 YIPF4 Yip1 domain family member 4 2 2
MIRT676029 C9orf69 transmembrane protein 250 2 2
MIRT679015 MTMR10 myotubularin related protein 10 2 2
MIRT679169 PSMB2 proteasome subunit beta 2 2 2
MIRT687413 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT688038 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT691644 SLC43A3 solute carrier family 43 member 3 2 2
MIRT695630 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697562 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT699153 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT699683 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT702177 LYRM4 LYR motif containing 4 2 2
MIRT706217 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT711243 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT712343 NLN neurolysin 2 2
MIRT716574 HOPX HOP homeobox 2 2
MIRT717443 TENM1 teneurin transmembrane protein 1 2 2
MIRT717759 KCNRG potassium channel regulator 2 2
MIRT717945 TUBD1 tubulin delta 1 2 2
MIRT718343 PURA purine rich element binding protein A 2 2
MIRT718773 ABHD15 abhydrolase domain containing 15 2 2
MIRT737073 FOXM1 forkhead box M1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-215 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-215 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-215 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-215 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-215 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-215 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-215-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HCT-116)
hsa-miR-215-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-215-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission