pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4457 |
Genomic Coordinates | chr5: 1309310 - 1309377 |
Description | Homo sapiens miR-4457 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4457 | |||||||||||||||||||||
Sequence | 43| UCACAAGGUAUUGACUGGCGUA |64 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | P2RY1 | ||||||||||||||||||||
Synonyms | P2Y1, SARCC | ||||||||||||||||||||
Description | purinergic receptor P2Y1 | ||||||||||||||||||||
Transcript | NM_002563 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on P2RY1 | |||||||||||||||||||||
3'UTR of P2RY1 (miRNA target sites are highlighted) |
>P2RY1|NM_002563|3'UTR 1 AGGCACAAGAATCTCCAAACACCTCTCTGTTGTAATATGGTAGGATGCTTAACAGAATCAAGTACTTTTCCCCTCTTTAA 81 CTTTCTAGTTTAGAAAAAAATCAAACCAAGAAAATAGTGAGTTAAAAAAATAATAGAAGTAGAAATGCCCACATCCACAC 161 TTAGCTTGTTTGGGTTTGCTTTCACAGTCTCTCTTCCTTCTGACTAGAAGTATGTATAATAAAACAATACTACCTAGTTA 241 AACATTTACTTTCTCTTTTGCCTTTAAAATGTGCAGGCTTTTCTGTTTAAAGTGTGTGTGCACATGAGTACTGGGGCTGT 321 TTTTGATATTAGTAATTTCTCTAAGAAAACTAGCCCCCTGCAACTTGAGTTTGTGGTTTATCTAGCCTTTATTGTTTTTT 401 TAAAATCCACAGTAGGAATAAAAAATCTATATTCTCAGAAATATCTAGCATGGTATATAACAAAACACTAAACTCATCAG 481 TTCATCCGGCATCAGATCAATGGATCTCTGAGCGGGGTGTTTTTTTCAGTGTCTTATAAGCATAGATGATAGTTGACTGA 561 GTTTCTTTAGGGCATTGAATAGACAAGTAAAGCTAATGAATTTAAAAGCCTGAAAAGTGATTGTTTTCCAGTTATTTCTG 641 GAAAAGGTCTCATTATATATTGGGTGCTAAATGTTTGATGGGGAAAGCCTGCATATATTATCGTACTGGTAAAATGCATT 721 CAAAATAATTAAAGTGCATGTATTTTCCTTGTAAACACCATGAGCTCTCTTAGACATCTTGTGATAAAGAGCATTTACTT 801 GCCCCACTGCTGTGCAATGCCTTAGGACTTTGTTTGTGTTCCAGGACAAGTGTTCACTCACATCTGTAAAAACAATTTTA 881 AGAATTGCAAATAAATTACAGACCAAAGATTGAGTAAAGTCAAATAACTGTTAGTAAGTTGAAGGATATTGGACAGGAGG 961 ACAGTATTTCAGAAAAGGAGAGGTTGACAGTCATCCACAAGGCATAGCCTCCAAGTATACTCTCAAATGTATGAAGCAAC 1041 TGGGGTGGGCAGAAGACATTTTAGAATGAGGGCTTTAGTTTAAATTAAAGTCATGGTGGAGAAGACTCTTGCTTCCTCCA 1121 AGTGTTTGAAAACACAAAATGCGATATGAAAAGAAGAAATAGAATTTGTATAGGTTGCATTGATAGAATGGGAAGCTATA 1201 ATCTTTGAATAAACCTTACATCTCAATATTTAAAGAAAAAACATATATATGGAGGGAAATATAGAGAATTAAAGTACCTA 1281 GATGCCATAGCACTGAAAAGTAAAGTACTACTCAAACTACTAATAGAAGACTATTGGTCAGTGTTTTCTATTATATTTGT 1361 TCTCTGCCAGGTGTTAATGAAAAATTTGTAAAATGCTTCAACAGTGTTAATAATTTTAATGAATATTGAATTGCTGCATG 1441 TCTAGTCCTTGAAATGGTCAAATTCTATATAATGAGAATAACAAGGTGAGATAATGCAATTGACAATCCCAAACAAATCC 1521 AGTGTCAAAGGAATTTTTAGTTTTGGAAGCTATCCCTCATAAAGTCAACATCAGAGTTTGCAACTGATGGTGGCATAACT 1601 TGTTTGAAAGCACTTTACAAGTAGAGCAACATGGGGCTGTATGTTAAGGCAAGAAAGAACCTTAGTGCCCCGTGGACCAT 1681 AATGACAGGAAATTTTCAGGTCTTGATTTCAGTTCTTGCAATGCCTATGTAGATTGAGGATTTGTGAGACCTTCAGAGTA 1761 GCTTCACTTTACCCAATCTCTGGCCACTAAGATCAATGAAGAAAAGCTGTATTTAACCTTCCAAAGCAGTGATTCTTTTT 1841 ACATGTTCAGTTTTAATGCATAGGATTATAGAAACCAAATCAAGAAGAAACCTACTACACCTCCTTATTTTGAGGAAAGA 1921 GAGGGTTAGCAAAGTTCTCACTTCATCAGGCTCAAATAACATCCGTTTTAGATTCCTACAAGACAAAATCTAAAATATGT 2001 CATTACTTTATTGACCTTGTTAAACAAGATCAATATCATTAAACTGACCAAGATGGAAATTACAGGACTTGTACCAGACT 2081 TGAACTTGTAGCCTAATGATACACATTTTTACAATATTTCTTCACCATTTAGTTTTCTTTCTTTTAGGTCTCAGGATGCT 2161 CAGCTTAATTTAGAGTATGTGTTAAGTACATTGTTTCAGCGTCCAGAGAATTTTGTGAGTGTGGATCCAGTGAGGAGGTG 2241 AACAGTAACTAGAAATGCTTGTTTACTACTTGGCATGTTTTTTCCAAAGTGTTTCTTCTTTAGCTTCATACATCACATAT 2321 GGACACTGATGACATGTGAATGCATGCCACATAGTAACAAGAATGATCTTGCCAACTCCTTCCAAGCCAAAAGAAGCCTC 2401 TGGGAAGGTGTGCCAATGGTGAAAACGTACAGAGGGTCAGGGTGAAGCAGTGATCTCTATTGGCTGAAAAACTGATCAGG 2481 TCATATGATGATTGAAGTATGTTTATTGTAAGGGCAGAAATGTGTTGGCATTTGGATAAAAAACTGCTAACATTATAGAA 2561 CTTATTACCTAACAAAATTTCACACCACAAAAAATATTTTAATGGCAAATTCAAGGTGTTTTATTGCTTACAAATCAGCA 2641 TCTTTGACTCTTTGAACATCAATTTGTGTTTACATTGAAATGACAAAAAGACAAACTAAGAAGAAATACAGCATGCAAGT 2721 TGGAATTCAGAGTTAAAACCATGATGTTGCCGCTCAGCCAGCTATGTGACTGTTGACCCTTTCAAGAACACACATGGATT 2801 TAAAAGTTGGATGACATCCATTGTTGGGGCCTTGGGGGATATGGTAAAGCATGAAAACTAAACAGCCAGGAGCCTGTGAA 2881 ATCTGCTACTGTATTTTCCAGGACTTCATTCCACTCCTTGGCTAAAAAAATCTTGGAAGTTTCACAGATTATGATGTGGA 2961 CCTGTCACCTGTAAATTGTCTCAATCTACTCAGACAAGACACTAAACTGTCTTTGGATACTATAGATGTCAGTGCTTATA 3041 GCAGCTGGAATTTGGCTAGTGACAATGTTTAAAGATGTAATACTAGTTAGTATCTATTGAAGCTTAAACTTTGCTGGTCA 3121 GGTTGTAGCTATTGTAAAAGTATTTATTGAAGAAGCTCACAGTCCTTCAGTTGTACAGACTGAAAAACTTTCATGAAAGA 3201 TCCAACATACTAATGTAAATTATATTTATTACAATGTATGATATTAATGTGTCAAACTGGTGTATTTTACAAAATATATA 3281 ATGCATACATAAATAAGAGTTGTATATTACAGTGCTTTTCAAATATCAGTGTCTTGGAATATTTAAGTCTTCACATTTTT 3361 TGGTCTAAAATATGAAAATGTTTCATGATACAAGTGATTAATTTTCCCTAGTAGTGCTTTTGCATGTTTGCCTTTTTATT 3441 TAAGTTTTTTTCTATATAGACACAATTTGGTGTCAGACTATCATAAGATCGATAGTGAATATAAAATATCTTAGCCAAAT 3521 GGGGTCTGTATTGTCTACATTTTATATATTAAATAAAAGTTTTTGTTGTCTTTTCAGGAGGTTTAGAGTATTGTCACTAA 3601 ATATGATCAAAGCTTCCCTTTCCAAATGCAAAAGTCTTGTCCTACATTTAAAGTTGATCTGTCATGTTTTAGCAGTCAAG 3681 TGGGATGGGCATTATATAAACAACGTTACAATGTAAGGAAAATCTTTAAGGAGATGGGGAGAGAAAAAGGCAGCTGGTAT 3761 AATCGGTTACTGCTGCTTAGTTCTACTTAATTTTTTGTGTTGCTTCTTCTTAAGGTGAGATAGCATAATCTTAACTGTTT 3841 TGAGATGGAATTTTAAAGTAACACACTACCAGCGAGTTCAACACTGCTATTGATTTTAATCTGTTTTTTTTTGTTTAGTT 3921 GATAACTTAAATTCCAAGTTTCATAGTGATAATTGTATATTATTTGGCTGCTGAATTCTGTTAGAGTTTTTTATTCTGTT 4001 GTACATTGTATTATACACATAATCACAAATTAATATGAAGGTGAATATATGTTACATATCAAAATTTGTGAATTTGAATT 4081 ATAGTATGTTTTAGTGCTATTGCAAAAAATGTTTATTTTTATATTATCTGTGATTTTAATATAGATGATTGAACTAGATT 4161 TCTTTTTGAGTGATAGTGCCATTGAATGAGCAGTATGGAAACAGTGTTACTTGATATTTTGAGCTTTCTCAGGTTTATCT 4241 AAATCAGTGGTAGCTTAACAAAACCCAGACTAATTGTGTGTAATTGTATTTTTAATAAAAGGAAAGTACATTTCCTATAA 4321 TAGCATAGTACTGTTTGCATGTAAGAGTATGCAAAACCTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTTAGT 4401 GTGTGTAAGGCATGGCAGCCAACTTTGTATCTGCTATTTTTAGTACGAGCAGAGCTTCATAATTGTGGTCACTAGAACTG 4481 TACTTACCATGGACAGTTAAAACTGAAAAAGACTCAATAAAACTATGAAACATGGAAAAAAAAAAAAAAAAAAAAAAAAA 4561 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | BCBL-1 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA
... - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al. - PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1
HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2
HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2
HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3
HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3
HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4
HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb
HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb
HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb
HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb
HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb
HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb
HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb
HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1015448 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | BCBL-1 / BCBL-1 mRNA |
Location of target site | ENST00000305097.3 | 3UTR | UUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUCUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22927820 / GSE41357 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000305097.3 | 3UTR | ACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000305097.3 | 3UTR | ACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084040 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep1 |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1084042 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep2 |
Location of target site | ENST00000305097.3 | 3UTR | AAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1084043 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep2 |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1084044 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep3 |
Location of target site | ENST00000305097.3 | 3UTR | AAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1084045 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep3 |
Location of target site | ENST00000305097.3 | 3UTR | CUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1084046 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep4 |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000305097.3 | 3UTR | AAAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 12 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 13 for dataset GSM1084066 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SantaCruzAb |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 14 for dataset GSM1084067 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_SantaCruzAb |
Location of target site | ENST00000305097.3 | 3UTR | ACCUUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 15 for dataset GSM1084069 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_SigmaAb |
Location of target site | ENST00000305097.3 | 3UTR | AAAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 16 for dataset GSM1084073 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 17 for dataset GSM1084075 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb |
Location of target site | ENST00000305097.3 | 3UTR | CUUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 18 for dataset GSM1084076 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_SigmaAb |
Location of target site | ENST00000305097.3 | 3UTR | AAGAGUAUGCAAAACCUUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 19 for dataset GSM1084077 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_SigmaAb |
Location of target site | ENST00000305097.3 | 3UTR | AAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 20 for dataset GSM1084078 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000305097.3 | 3UTR | AAACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 21 for dataset GSM1084079 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000305097.3 | 3UTR | ACCUUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 22 for dataset GSM1084083 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SigmaAb |
Location of target site | ENST00000305097.3 | 3UTR | CUUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 23 for dataset GSM1013116 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | hMSC / hMSC-replicate-5 |
Location of target site | ENST00000305097.3 | 3UTR | AACCUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24038734 / GSE41272 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT098032 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT202580 | PCMTD2 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT247137 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT349266 | PTBP1 | polypyrimidine tract binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT363756 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443586 | FAM84B | family with sequence similarity 84 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452333 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453864 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 4 | ||||||
MIRT471486 | PDE4D | phosphodiesterase 4D | ![]() |
![]() |
2 | 4 | ||||||
MIRT476290 | GMFB | glia maturation factor beta | ![]() |
![]() |
2 | 8 | ||||||
MIRT479897 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484251 | ANK1 | ankyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491473 | TMEM214 | transmembrane protein 214 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493804 | GAN | gigaxonin | ![]() |
![]() |
2 | 6 | ||||||
MIRT499252 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT502271 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504651 | RPL9 | ribosomal protein L9 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505211 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT508952 | SNRPB | small nuclear ribonucleoprotein polypeptides B and B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512691 | POP1 | POP1 homolog, ribonuclease P/MRP subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT513320 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513870 | HOXA5 | homeobox A5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517342 | ZNF529 | zinc finger protein 529 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518947 | LSG1 | large 60S subunit nuclear export GTPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520867 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT528325 | GIGYF2 | GRB10 interacting GYF protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531990 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533298 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545257 | TRIM36 | tripartite motif containing 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547038 | POGZ | pogo transposable element derived with ZNF domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT556103 | MOAP1 | modulator of apoptosis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558321 | DR1 | down-regulator of transcription 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558521 | CSRNP3 | cysteine and serine rich nuclear protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560906 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568448 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570586 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT572799 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573863 | C9orf78 | chromosome 9 open reading frame 78 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575058 | P2ry1 | purinergic receptor P2Y, G-protein coupled 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT609931 | SLC38A1 | solute carrier family 38 member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT610836 | ZNF585A | zinc finger protein 585A | ![]() |
![]() |
2 | 4 | ||||||
MIRT611474 | P2RY1 | purinergic receptor P2Y1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT613569 | YY2 | YY2 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT618626 | GREB1 | growth regulation by estrogen in breast cancer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620606 | SAP30 | Sin3A associated protein 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621017 | CLSTN3 | calsyntenin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT635314 | FAM179A | TOG array regulator of axonemal microtubules 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635919 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT640598 | TM9SF4 | transmembrane 9 superfamily member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641784 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT644067 | IQCE | IQ motif containing E | ![]() |
![]() |
2 | 2 | ||||||
MIRT648288 | TRAPPC2L | trafficking protein particle complex 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT658085 | FOXR2 | forkhead box R2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659077 | DEPTOR | DEP domain containing MTOR interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT665307 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665975 | SYTL4 | synaptotagmin like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666302 | SLC25A25 | solute carrier family 25 member 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674906 | RASSF9 | Ras association domain family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680086 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681488 | DIP2A | disco interacting protein 2 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT691244 | DFNB59 | pejvakin | ![]() |
![]() |
2 | 2 | ||||||
MIRT692362 | AGTRAP | angiotensin II receptor associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT693035 | MB21D1 | Mab-21 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693837 | STAT5A | signal transducer and activator of transcription 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT694479 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT696070 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696578 | TTC21B | tetratricopeptide repeat domain 21B | ![]() |
![]() |
2 | 2 | ||||||
MIRT696760 | MTFMT | mitochondrial methionyl-tRNA formyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT697307 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700152 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701056 | PARP2 | poly(ADP-ribose) polymerase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701198 | OTUD3 | OTU deubiquitinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701335 | NSD1 | nuclear receptor binding SET domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702656 | ITGA3 | integrin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703618 | FBXO45 | F-box protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704673 | CHTOP | chromatin target of PRMT1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708894 | ZNF780A | zinc finger protein 780A | ![]() |
![]() |
2 | 2 | ||||||
MIRT711620 | DGKH | diacylglycerol kinase eta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713745 | TMEM81 | transmembrane protein 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719712 | CD101 | CD101 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT720294 | DLGAP3 | DLG associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722606 | CCDC152 | coiled-coil domain containing 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724566 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|