miRTarBase - #MIRT612019


—
pre-miRNA Information
pre-miRNA hsa-mir-7156   
Genomic Coordinates chr1: 77060143 - 77060202
Description Homo sapiens miR-7156 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7156-5p
Sequence 1| UUGUUCUCAAACUGGCUGUCAGA |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs907711107 9 dbSNP
rs940406061 22 dbSNP
Putative Targets

Gene Information
Gene Symbol PAK6   
Synonyms PAK5
Description p21 (RAC1) activated kinase 6
Transcript NM_001128628   
Other Transcripts NM_001128629 , NM_020168   
Expression
Putative miRNA Targets on PAK6
3'UTR of PAK6
(miRNA target sites are highlighted)		 
>PAK6|NM_001128628|3'UTR
   1 GCCCACCCCAAGTATGCCTGCCACCTACGCCCACAGGCAGGGCACACTGGGCAGCCAGCCTGCCGGCAGGACTTGCCTGC
  81 CTCCTCCTCTCAGTATTCTCTCCAAAGATTGAAATGTGAAGCCCCAGCCCCACCCTCTGCCCTTCAGCCTACTGGGCCAG
 161 GCCGGACCTGCCCCCTCAGTGTCTCTCCCTCCCGAGTCCCCAGATGGAGACCCCTTTCTACAGGATGACCCCTTGATATT
 241 TGCACAGGGATATTTCTAAGAAACGCAGAGGCCAGCGTTCCTGGCCTCTGCAGCCAACACAGTAGAAAAGGCTGCTGTGG
 321 TTTTTTAAAGGCAGTTGTCCACTAGTGTCCTAGGCCACTGCAGAGGGCAGACTGCTGGTCTCCACAGATACCTGCTGTTC
 401 TCAGCTCCAGCTTCAAACCTCGAGTCTCGAGAGGGCCACGGGGTGGTTTTTATGACCGGAATCCCGCTTCCTCCCTCACG
 481 TCTGATGTCCTGAAGGTGCAGTCCCACCTGTACAGCCCCTCCCCGCCCAGAACTGTGAATGGCCTGCTCCAGGCCATGGC
 561 TGGGGGCAGGGAGTGAGGGGACAATTTCTGAGTGAAAGAGAAAGAATGGGGTCGGTGGTGAAGGTGCTCTCACTTTACAG
 641 AATGGAGAGAACATCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAAGGGGAGGAAAGCCACCTTGACAG
 721 CCCAGGTCCCTCCAGGTCACCCACAGCCAGTTTCAGGAAGGCTGCCCCTCTCTCCCACTAAGTTCTGGCCTGAAGGGACC
 801 TGCTTTCTTGGCCTGGCTTCCACCTCTCCACTCCTGTGTCTACCTGGCCAGTGGAGTGGTCCATGCTAAGTCTAACACTC
 881 CTGGGAGCTCAGGAGGCTTCTGAGCTTCTCCTGTACTGTGCATCGTGAGGGCCAGAGACAGGAATGTAAGGATTGGCAAC
 961 TGTGTTACCTTTCAAGTTTATCTCAATAACCAGGTCATCAGGGACCCATTGTTCTCTTCAGAACCCTATCTGGGAGAGAA
1041 GGCGAACCACCTCCGGGTTTCCATCATGTCAAGGTCACAGGCATCCATGTGTGCAAACCATCTGCCCCAGCTGCCTCCAC
1121 AGACTGCTGTCTCCTTGTCCTCCTCGGCCCTGCCCCACTTCAGGGCTGCTGTGAGATGGAATTCCAGGAAAGAACTTCAG
1201 GTGTCTGGACCCTTTCTATCTAGATAATATTTTTAGATTCTTCTGCTCCCTAGTGACCTACCTGGGGGCAAAGAAATTGC
1281 AAGGACTTTTTTTTAAGGGTCAGAGTTTTCAAAACAAAAGCATCTTCCCTAGAAATTTTTGTGAATTGTTTGCACTTGTG
1361 CCTGTTTTAAATTAAATTGAGTGTTCAAAGCCAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agACUGUCGGUCA-AACUCUUGUu 5'
            | ||||  | |   ||||||| 
Target 5' ctTTACAG--AATGGAGAGAACAt 3'
 633 - 654 145.00 -11.70
2 
miRNA  3' agaCUGUCGGUCAAACUCUUGUu 5'
             |:|||  |||  |:|:||| 
Target 5' gggGGCAGGGAGTGAGGGGACAa 3'
 562 - 584 132.00 -18.70
3 
miRNA  3' agacugUCGGUCA-AACUCUUGUu 5'
                :|||| |   |||::|| 
Target 5' gtcctaGGCCACTGCAGAGGGCAg 3'
 347 - 370 117.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19750618 10 COSMIC
COSN5754323 17 COSMIC
COSN30652269 29 COSMIC
COSN32053345 37 COSMIC
COSN26987842 47 COSMIC
COSN20078222 49 COSMIC
COSN30481348 85 COSMIC
COSN30487638 99 COSMIC
COSN22795269 107 COSMIC
COSN31529963 108 COSMIC
COSN13617822 112 COSMIC
COSN30535573 112 COSMIC
COSN26550636 155 COSMIC
COSN26576149 179 COSMIC
COSN26644320 188 COSMIC
COSN31538579 371 COSMIC
COSN20956876 447 COSMIC
COSN26562875 526 COSMIC
COSN28720151 529 COSMIC
COSN22632090 550 COSMIC
COSN31540542 628 COSMIC
COSN20111941 689 COSMIC
COSN27531722 696 COSMIC
COSN28940026 696 COSMIC
COSN24433213 703 COSMIC
COSN9624677 1053 COSMIC
COSN31547692 1241 COSMIC
COSN29468775 1265 COSMIC
COSN31547287 1274 COSMIC
COSN31534741 1291 COSMIC
COSN31553235 1295 COSMIC
COSN31486183 1335 COSMIC
COSN1675712 1363 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1374866137 3 dbSNP
rs770148451 11 dbSNP
rs886881730 13 dbSNP
rs768177934 16 dbSNP
rs777964096 18 dbSNP
rs749353475 21 dbSNP
rs1303826049 29 dbSNP
rs771451960 30 dbSNP
rs1003879391 37 dbSNP
rs370753710 41 dbSNP
rs746236323 43 dbSNP
rs772480323 48 dbSNP
rs1218852362 52 dbSNP
rs775843748 53 dbSNP
rs1008467992 54 dbSNP
rs1019826921 55 dbSNP
rs964230654 56 dbSNP
rs1206862746 58 dbSNP
rs549329294 60 dbSNP
rs1035797029 63 dbSNP
rs753647873 65 dbSNP
rs1012840108 66 dbSNP
rs1410098775 67 dbSNP
rs925452732 72 dbSNP
rs777539725 79 dbSNP
rs1188852213 80 dbSNP
rs958052358 80 dbSNP
rs1263050854 87 dbSNP
rs1189104389 93 dbSNP
rs869233933 96 dbSNP
rs1480472903 97 dbSNP
rs1486827445 103 dbSNP
rs1022778589 104 dbSNP
rs1180490524 112 dbSNP
rs1431977746 114 dbSNP
rs568122908 123 dbSNP
rs1308192214 130 dbSNP
rs1275175926 131 dbSNP
rs1212826089 134 dbSNP
rs34376657 147 dbSNP
rs1416403006 148 dbSNP
rs1353314470 150 dbSNP
rs913606618 156 dbSNP
rs574597303 164 dbSNP
rs956354542 165 dbSNP
rs987457954 171 dbSNP
rs1167745002 172 dbSNP
rs949032392 175 dbSNP
rs1330421107 179 dbSNP
rs1046055991 182 dbSNP
rs926533333 192 dbSNP
rs553791008 195 dbSNP
rs937912037 199 dbSNP
rs535321936 202 dbSNP
rs763496646 220 dbSNP
rs1408928313 223 dbSNP
rs1481092972 230 dbSNP
rs943601348 253 dbSNP
rs898979402 265 dbSNP
rs1039275427 266 dbSNP
rs1273796892 269 dbSNP
rs1235054572 271 dbSNP
rs570507832 278 dbSNP
rs1311771736 281 dbSNP
rs930793817 282 dbSNP
rs1224092467 283 dbSNP
rs887154416 287 dbSNP
rs1296038144 294 dbSNP
rs1405449597 295 dbSNP
rs1282615682 311 dbSNP
rs1394577425 321 dbSNP
rs776409357 321 dbSNP
rs1342911254 324 dbSNP
rs557179692 340 dbSNP
rs1367182113 343 dbSNP
rs1004375742 351 dbSNP
rs34276379 353 dbSNP
rs895487700 354 dbSNP
rs997091634 356 dbSNP
rs1203366297 369 dbSNP
rs1032954125 373 dbSNP
rs1253681932 376 dbSNP
rs1271460317 379 dbSNP
rs1490630841 381 dbSNP
rs1215586736 383 dbSNP
rs576272975 383 dbSNP
rs1012809410 384 dbSNP
rs1467108569 386 dbSNP
rs1199270464 387 dbSNP
rs2242120 391 dbSNP
rs988337956 393 dbSNP
rs968664277 419 dbSNP
rs1000023967 427 dbSNP
rs1020717085 429 dbSNP
rs192345226 430 dbSNP
rs956110817 434 dbSNP
rs36068492 440 dbSNP
rs981785136 441 dbSNP
rs1454685443 443 dbSNP
rs911869180 446 dbSNP
rs1395879894 452 dbSNP
rs937948256 455 dbSNP
rs34042288 459 dbSNP
rs1266661568 460 dbSNP
rs557795583 466 dbSNP
rs564137547 467 dbSNP
rs1329286666 471 dbSNP
rs1215558300 474 dbSNP
rs1432879679 480 dbSNP
rs577644966 481 dbSNP
rs1329986618 501 dbSNP
rs543744537 508 dbSNP
rs1226434653 509 dbSNP
rs1364640819 510 dbSNP
rs781068575 513 dbSNP
rs563975379 514 dbSNP
rs939760937 518 dbSNP
rs1376307751 523 dbSNP
rs1057295547 524 dbSNP
rs895593975 525 dbSNP
rs529584226 526 dbSNP
rs2242119 529 dbSNP
rs756243111 534 dbSNP
rs1430257325 536 dbSNP
rs1288276379 544 dbSNP
rs1192668263 550 dbSNP
rs559734882 551 dbSNP
rs1485841113 557 dbSNP
rs887205288 559 dbSNP
rs778317005 561 dbSNP
rs1259251288 562 dbSNP
rs1031480242 564 dbSNP
rs891637466 576 dbSNP
rs1194602827 589 dbSNP
rs1228922736 594 dbSNP
rs1242157505 594 dbSNP
rs1276794074 595 dbSNP
rs1008760516 601 dbSNP
rs1399845517 608 dbSNP
rs1019429122 612 dbSNP
rs540941342 614 dbSNP
rs1041047236 615 dbSNP
rs189289921 616 dbSNP
rs1386714011 618 dbSNP
rs144984113 619 dbSNP
rs1168597065 627 dbSNP
rs1463527989 627 dbSNP
rs879617507 628 dbSNP
rs1027618695 639 dbSNP
rs1169850913 646 dbSNP
rs562270058 647 dbSNP
rs1162421129 651 dbSNP
rs1475450618 652 dbSNP
rs1388395747 654 dbSNP
rs745940726 655 dbSNP
rs762285822 655 dbSNP
rs113864236 656 dbSNP
rs1183532110 656 dbSNP
rs1213724468 656 dbSNP
rs1237015351 656 dbSNP
rs1292562503 656 dbSNP
rs1364075710 656 dbSNP
rs1437326428 656 dbSNP
rs1469332578 656 dbSNP
rs1469414750 656 dbSNP
rs371193727 656 dbSNP
rs58716292 656 dbSNP
rs761192181 656 dbSNP
rs773753868 656 dbSNP
rs780685892 656 dbSNP
rs879097663 656 dbSNP
rs879152435 656 dbSNP
rs1491478281 657 dbSNP
rs952256885 657 dbSNP
rs1356070094 658 dbSNP
rs1241415341 659 dbSNP
rs997539556 659 dbSNP
rs984125344 661 dbSNP
rs1032590555 664 dbSNP
rs1318957309 665 dbSNP
rs1396615773 667 dbSNP
rs1321495374 671 dbSNP
rs1225828870 672 dbSNP
rs1404622350 674 dbSNP
rs1385366722 675 dbSNP
rs1159992467 684 dbSNP
rs1387943656 686 dbSNP
rs759770129 687 dbSNP
rs776953736 687 dbSNP
rs894007126 687 dbSNP
rs1417513548 695 dbSNP
rs67205800 696 dbSNP
rs866699648 697 dbSNP
rs1164633107 698 dbSNP
rs1383814404 701 dbSNP
rs1244408214 703 dbSNP
rs1193715136 713 dbSNP
rs1249023452 715 dbSNP
rs1282782139 720 dbSNP
rs1197360818 726 dbSNP
rs1353335605 731 dbSNP
rs1206214606 736 dbSNP
rs1009748106 740 dbSNP
rs547541205 741 dbSNP
rs75122003 744 dbSNP
rs908004763 747 dbSNP
rs1021106732 752 dbSNP
rs1278992472 757 dbSNP
rs775248975 765 dbSNP
rs371075338 768 dbSNP
rs970485809 770 dbSNP
rs1464017671 773 dbSNP
rs1369815947 775 dbSNP
rs1273048488 782 dbSNP
rs939500317 787 dbSNP
rs1206299207 793 dbSNP
rs1320087682 797 dbSNP
rs992381497 803 dbSNP
rs1359507904 814 dbSNP
rs916997170 816 dbSNP
rs1444861894 820 dbSNP
rs1186452322 836 dbSNP
rs1033375682 841 dbSNP
rs183657807 843 dbSNP
rs1366478954 853 dbSNP
rs111385535 855 dbSNP
rs1196303695 858 dbSNP
rs1487505557 865 dbSNP
rs1262824376 871 dbSNP
rs1211830020 880 dbSNP
rs1314073532 887 dbSNP
rs549532737 915 dbSNP
rs935905671 919 dbSNP
rs1053432713 922 dbSNP
rs569885849 925 dbSNP
rs187963215 926 dbSNP
rs771401806 928 dbSNP
rs1416218041 932 dbSNP
rs1357021610 934 dbSNP
rs1332966432 938 dbSNP
rs944153368 942 dbSNP
rs555529904 950 dbSNP
rs538208874 952 dbSNP
rs1173450623 954 dbSNP
rs900559638 956 dbSNP
rs55738516 958 dbSNP
rs1027586159 959 dbSNP
rs932668997 964 dbSNP
rs1189037992 966 dbSNP
rs116029092 976 dbSNP
rs983499271 986 dbSNP
rs1438449922 995 dbSNP
rs529576098 996 dbSNP
rs1216685781 1001 dbSNP
rs1042604430 1004 dbSNP
rs1327685759 1013 dbSNP
rs906688280 1017 dbSNP
rs1003329111 1025 dbSNP
rs961024820 1028 dbSNP
rs1376524273 1034 dbSNP
rs1301840005 1035 dbSNP
rs992703498 1042 dbSNP
rs1442388017 1044 dbSNP
rs1401803413 1045 dbSNP
rs746353782 1050 dbSNP
rs1464543492 1055 dbSNP
rs948428226 1055 dbSNP
rs959344122 1056 dbSNP
rs544518984 1064 dbSNP
rs775941010 1068 dbSNP
rs1411965181 1069 dbSNP
rs994525404 1072 dbSNP
rs935648699 1074 dbSNP
rs1470574868 1075 dbSNP
rs1240074854 1079 dbSNP
rs1052828849 1086 dbSNP
rs1027710153 1090 dbSNP
rs1264429351 1093 dbSNP
rs1457284459 1095 dbSNP
rs1273662658 1101 dbSNP
rs543774235 1102 dbSNP
rs1319698868 1103 dbSNP
rs762512561 1104 dbSNP
rs983318069 1107 dbSNP
rs563539227 1112 dbSNP
rs911758480 1121 dbSNP
rs1306499095 1135 dbSNP
rs965846193 1136 dbSNP
rs11635121 1146 dbSNP
rs75108621 1147 dbSNP
rs1182270233 1155 dbSNP
rs1411030498 1156 dbSNP
rs932701981 1160 dbSNP
rs1471565356 1162 dbSNP
rs759198408 1163 dbSNP
rs1040142774 1167 dbSNP
rs1164404511 1170 dbSNP
rs559962933 1177 dbSNP
rs900361094 1181 dbSNP
rs1382359948 1189 dbSNP
rs138256759 1190 dbSNP
rs1439100432 1193 dbSNP
rs552017670 1199 dbSNP
rs1430047838 1200 dbSNP
rs1487411420 1204 dbSNP
rs1264663917 1208 dbSNP
rs887890232 1213 dbSNP
rs1042656246 1219 dbSNP
rs1465626185 1224 dbSNP
rs1371081876 1238 dbSNP
rs906739688 1238 dbSNP
rs1003716971 1246 dbSNP
rs1170995185 1249 dbSNP
rs1005286242 1269 dbSNP
rs1392242756 1274 dbSNP
rs1307805753 1281 dbSNP
rs1349064009 1284 dbSNP
rs1400920145 1284 dbSNP
rs894912976 1285 dbSNP
rs1178267218 1287 dbSNP
rs1378254280 1287 dbSNP
rs994977143 1287 dbSNP
rs1407276254 1305 dbSNP
rs1014936129 1306 dbSNP
rs950378207 1324 dbSNP
rs961208217 1326 dbSNP
rs1004793671 1330 dbSNP
rs1312223958 1333 dbSNP
rs1231901006 1342 dbSNP
rs1260679331 1349 dbSNP
rs1013865226 1355 dbSNP
rs1341015997 1367 dbSNP
rs1348032982 1367 dbSNP
rs1023781042 1369 dbSNP
rs564140113 1387 dbSNP
rs1310958956 1390 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BCBL-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA ...

- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens.

Article - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al.
- PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1 HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1 HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2 HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2550620. RNA binding protein: AGO2. Condition:Patient 2 Tumor 1 HITS-CLIP data was present in GSM2550619. RNA binding protein: AGO2. Condition:Patient 1 Tumor 2 HITS-CLIP data was present in GSM2550618. RNA binding protein: AGO2. Condition:Patient 1 Tumor 1 ...

- Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al., 2017, Molecular cell.

Article - Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al.
- Molecular cell, 2017
MicroRNA-122, an abundant and conserved liver-specific miRNA, regulates hepatic metabolism and functions as a tumor suppressor, yet systematic and direct biochemical elucidation of the miR-122 target network remains incomplete. To this end, we performed Argonaute crosslinking immunoprecipitation (Argonaute [Ago]-CLIP) sequencing in miR-122 knockout and control mouse livers, as well as in matched human hepatocellular carcinoma (HCC) and benign liver tissue to identify miRNA target sites transcriptome-wide in two species. We observed a majority of miR-122 binding on 3' UTRs and coding exons followed by extensive binding to other genic and non-genic sites. Motif analysis of miR-122-dependent binding revealed a G-bulged motif in addition to canonical motifs. A large number of miR-122 targets were found to be species specific. Upregulation of several common mouse and human targets, most notably BCL9, predicted survival in HCC patients. These results broadly define the molecular consequences of miR-122 downregulation in hepatocellular carcinoma.
LinkOut: [PMID: 28735896]
CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1015448
Method / RBP HITS-CLIP / AGO2
Cell line / Condition BCBL-1 / BCBL-1 mRNA
Location of target site ENST00000260404.4 | 3UTR | CAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22927820 / GSE41357
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000260404.4 | 3UTR | AUCGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084040
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep1
Location of target site ENST00000260404.4 | 3UTR | AACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084041
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep1
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084042
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep2
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000260404.4 | 3UTR | AACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | AACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1084067
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SantaCruzAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | AACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | GAGAGAACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | UACAGAAUGGAGAGAACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 21 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 22 for dataset GSM1084075
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 23 for dataset GSM1084076
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 24 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | AACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 25 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 26 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 27 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 28 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 29 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000260404.4 | 3UTR | ACAUCGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
71 hsa-miR-7156-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071889 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT089448 STAMBP STAM binding protein 2 2
MIRT135061 ADSS adenylosuccinate synthase 2 4
MIRT279713 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT314693 TMEM167A transmembrane protein 167A 2 2
MIRT405292 ARF1 ADP ribosylation factor 1 2 2
MIRT449941 IGF1 insulin like growth factor 1 2 2
MIRT450241 TRIM66 tripartite motif containing 66 2 2
MIRT450266 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450683 RPN2 ribophorin II 2 2
MIRT465595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT479853 CCDC6 coiled-coil domain containing 6 2 2
MIRT487158 IFRD1 interferon related developmental regulator 1 2 6
MIRT506338 NUP54 nucleoporin 54 2 4
MIRT514596 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT525340 TUBGCP4 tubulin gamma complex associated protein 4 2 2
MIRT528088 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT529251 TRIM4 tripartite motif containing 4 2 4
MIRT552786 YAF2 YY1 associated factor 2 2 2
MIRT554463 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT557667 GATA6 GATA binding protein 6 2 2
MIRT565808 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566342 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567793 DEK DEK proto-oncogene 2 2
MIRT572456 ZNF516 zinc finger protein 516 2 2
MIRT572583 HGFAC HGF activator 2 2
MIRT574650 LMAN2 lectin, mannose binding 2 2 2
MIRT608165 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT612019 PAK6 p21 (RAC1) activated kinase 6 2 8
MIRT616033 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT621925 SYAP1 synapse associated protein 1 2 4
MIRT624611 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT635086 AKIRIN1 akirin 1 2 2
MIRT636154 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638256 SIX1 SIX homeobox 1 2 2
MIRT638485 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT639396 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641787 USP32 ubiquitin specific peptidase 32 2 2
MIRT642300 FPR1 formyl peptide receptor 1 2 2
MIRT644555 SPOP speckle type BTB/POZ protein 2 2
MIRT645901 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT657250 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659907 CACNG2 calcium voltage-gated channel auxiliary subunit gamma 2 2 2
MIRT665371 XIAP X-linked inhibitor of apoptosis 2 2
MIRT667268 NAV1 neuron navigator 1 2 2
MIRT669215 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT674142 ZNF793 zinc finger protein 793 2 2
MIRT698726 STX6 syntaxin 6 2 4
MIRT699789 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700291 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710005 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT710408 YTHDC1 YTH domain containing 1 2 2
MIRT710570 TNPO1 transportin 1 2 2
MIRT711055 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711281 PSME3 proteasome activator subunit 3 2 2
MIRT711385 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712718 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713289 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715650 USP6NL USP6 N-terminal like 2 2
MIRT716168 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716757 TRABD2A TraB domain containing 2A 2 2
MIRT718362 SOX1 SRY-box 1 2 2
MIRT719672 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720828 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722185 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722400 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723461 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724073 NCKAP1L NCK associated protein 1 like 2 2
MIRT724595 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725235 PDE1B phosphodiesterase 1B 2 2
MIRT725585 CDH7 cadherin 7 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7156 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-7156-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission