pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-155 |
Genomic Coordinates | chr21: 25573980 - 25574044 |
Description | Homo sapiens miR-155 stem-loop |
Comment | Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-155-3p | ||||||||||||||||||
Sequence | 43| CUCCUACAUAUUAGCAUUAACA |64 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | GTDC1 | ||||||||||||||||||||
Synonyms | Hmat-Xa, mat-Xa | ||||||||||||||||||||
Description | glycosyltransferase like domain containing 1 | ||||||||||||||||||||
Transcript | NM_001006636 | ||||||||||||||||||||
Other Transcripts | NM_001164629 , NM_024659 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on GTDC1 | |||||||||||||||||||||
3'UTR of GTDC1 (miRNA target sites are highlighted) |
>GTDC1|NM_001006636|3'UTR 1 CAGATGGGGCTAAGTCACAAACTTGCAGCCTAAGGCAGAATCTGAAGAACTTTCCAGAGTGTGCCCATATTTACCTGATC 81 AGAGAGAAAAGAAAATCTGCAGAGGAAGCTGAGCCTGGCTGCTTGTCATAGCTGACACAGAGCCATCTGCCACAAACCTG 161 TGGCGGCTTCAGATCTCCAATCCCTGCCACCACCCCAACTCAAATTAAATACAGATTCCTAGAGACGTTATGATGGTTAC 241 ACATGTCCTCGGCATCACATGTAGGAGACTGTTCAAAAAAAATATGTGGCCTGTTGTATAACCGCACTCATGTATCCCAT 321 ATGTGGTGCCACATTGAATTTCCGGTTGAATCCGTTTTTATCCTTTGTACTGGATGACATGGTGCCTGAATTCTTTCTTT 401 TCGCCGACACGATGGCAGCCAAACTGCAGCTTCAAACGCTCACACTTGGCTGGGTTTCTACCTAGGTTGCCAGGTTATCA 481 TCGGAGCCTTCTTGTGTCCTCAAAGGGCCACGAGGCCTGAAAGGAGGATCAGAATGCTTTGGGATTAATTGGGCAGCCAT 561 CGCAGAATTGTTTGTGGGCAAAGGGCTGCTTTAGCACTTTTCTTTTAGCAAATTAATGACTCTCAGGCACAGGGGGTTTT 641 AAGTGAAGGTATTAATAAGAGGTCTGGCAGGTATTCCCATGATTCACAGAGTTACATTTGCATTTAATTAATCTTAAAGT 721 TGCAAGATAAACAGCTGTAATTCGGACAAACATGACAAACACAGTGAAGCCAACTATCCCATAAAATGAACACTGACATA 801 CTTGTTTTAATTTTTTTCCCAGCGTAAAAATAGAAAAATCAAAATACTCCTAACAAAACCAGTGATTTTGATAGAAATAT 881 TTCTCCAATATACTTGCATCCACCTACAAATATAACCTTTTCAAGATAAATCGCTTATGATTTCAATAGTCAAACTGCTG 961 TGTTTGTTGATGTAAAGATGTTTTGAATGGCTAGATGGTAAAATAAATTCTTAATAAAGTACCCACTGCAATTTTTAAAA 1041 AAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1
HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1
HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2
HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2
HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3
HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3
HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4
HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb
HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb
HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb
HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb
HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb
HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb
HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb
HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb
HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb
HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb
HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb
HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb
HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Cardiac Tissues |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000392869.2 | 3UTR | AUGUAGGAGUGUGUGUGUGUGUGUGUGUGUGCACACG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1084040 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep1 |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084041 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep1 |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1084042 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep2 |
Location of target site | ENST00000392869.2 | 3UTR | AGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1084043 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep2 |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1084044 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep3 |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGUGCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1084045 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep3 |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUGUGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1084046 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep4 |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 12 for dataset GSM1084066 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SantaCruzAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 13 for dataset GSM1084067 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_SantaCruzAb |
Location of target site | ENST00000392869.2 | 3UTR | UAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 14 for dataset GSM1084068 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 15 for dataset GSM1084069 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | AUAUGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 16 for dataset GSM1084072 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 17 for dataset GSM1084073 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 18 for dataset GSM1084075 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb |
Location of target site | ENST00000392869.2 | 3UTR | UAGGAGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 19 for dataset GSM1084076 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 20 for dataset GSM1084077 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | UAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 21 for dataset GSM1084078 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 22 for dataset GSM1084079 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 23 for dataset GSM1084081 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb |
Location of target site | ENST00000392869.2 | 3UTR | GUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 24 for dataset GSM1084082 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | UAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 25 for dataset GSM1084083 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SigmaAb |
Location of target site | ENST00000392869.2 | 3UTR | UGUAGGAGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
73 hsa-miR-155-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT005808 | IRAK3 | interleukin 1 receptor associated kinase 3 | 4 | 1 | ||||||||
MIRT082844 | ZNF460 | zinc finger protein 460 | 2 | 4 | ||||||||
MIRT256047 | UBE2K | ubiquitin conjugating enzyme E2 K | 2 | 4 | ||||||||
MIRT437787 | PTEN | phosphatase and tensin homolog | 2 | 1 | ||||||||
MIRT456168 | ZDHHC6 | zinc finger DHHC-type containing 6 | 2 | 2 | ||||||||
MIRT464916 | TXNIP | thioredoxin interacting protein | 2 | 4 | ||||||||
MIRT475559 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | 2 | 2 | ||||||||
MIRT499608 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | 2 | 8 | ||||||||
MIRT504220 | MYO6 | myosin VI | 2 | 4 | ||||||||
MIRT504256 | C1orf147 | chromosome 1 open reading frame 147 | 2 | 4 | ||||||||
MIRT507642 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT522858 | KIAA1551 | KIAA1551 | 2 | 2 | ||||||||
MIRT527505 | MYD88 | myeloid differentiation primary response 88 | 5 | 2 | ||||||||
MIRT530713 | ORMDL3 | ORMDL sphingolipid biosynthesis regulator 3 | 2 | 2 | ||||||||
MIRT532851 | ZNF699 | zinc finger protein 699 | 2 | 2 | ||||||||
MIRT535952 | MIA3 | MIA family member 3, ER export factor | 2 | 2 | ||||||||
MIRT539041 | ATXN1L | ataxin 1 like | 2 | 4 | ||||||||
MIRT556391 | LUC7L | LUC7 like | 2 | 2 | ||||||||
MIRT558617 | CNOT6L | CCR4-NOT transcription complex subunit 6 like | 2 | 2 | ||||||||
MIRT559869 | ATXN3 | ataxin 3 | 2 | 2 | ||||||||
MIRT569208 | SHC3 | SHC adaptor protein 3 | 2 | 2 | ||||||||
MIRT573122 | C18orf25 | chromosome 18 open reading frame 25 | 2 | 2 | ||||||||
MIRT575076 | Ddit4 | DNA-damage-inducible transcript 4 | 2 | 2 | ||||||||
MIRT607597 | ABCF3 | ATP binding cassette subfamily F member 3 | 2 | 6 | ||||||||
MIRT609386 | PHEX | phosphate regulating endopeptidase homolog X-linked | 2 | 2 | ||||||||
MIRT610550 | MDN1 | midasin AAA ATPase 1 | 2 | 2 | ||||||||
MIRT612390 | TCF7L2 | transcription factor 7 like 2 | 2 | 2 | ||||||||
MIRT612910 | GTDC1 | glycosyltransferase like domain containing 1 | 2 | 6 | ||||||||
MIRT613314 | ARL5C | ADP ribosylation factor like GTPase 5C | 2 | 2 | ||||||||
MIRT613356 | ADAMTS5 | ADAM metallopeptidase with thrombospondin type 1 motif 5 | 2 | 4 | ||||||||
MIRT613541 | CLMP | CXADR like membrane protein | 2 | 2 | ||||||||
MIRT617029 | SYT6 | synaptotagmin 6 | 2 | 2 | ||||||||
MIRT618044 | MRVI1 | murine retrovirus integration site 1 homolog | 2 | 2 | ||||||||
MIRT619307 | KIRREL | kirre like nephrin family adhesion molecule 1 | 2 | 2 | ||||||||
MIRT623209 | MTFR1L | mitochondrial fission regulator 1 like | 2 | 2 | ||||||||
MIRT625448 | RANGAP1 | Ran GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT634551 | MACC1 | MACC1, MET transcriptional regulator | 2 | 2 | ||||||||
MIRT640740 | EPB41 | erythrocyte membrane protein band 4.1 | 2 | 2 | ||||||||
MIRT640906 | RAB13 | RAB13, member RAS oncogene family | 2 | 2 | ||||||||
MIRT644025 | ZNF792 | zinc finger protein 792 | 2 | 2 | ||||||||
MIRT651489 | WT1 | Wilms tumor 1 | 2 | 2 | ||||||||
MIRT652037 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT669093 | CDK6 | cyclin dependent kinase 6 | 2 | 2 | ||||||||
MIRT696720 | WNT3 | Wnt family member 3 | 2 | 2 | ||||||||
MIRT698085 | TPM1 | tropomyosin 1 | 2 | 2 | ||||||||
MIRT703284 | GID4 | GID complex subunit 4 homolog | 2 | 2 | ||||||||
MIRT707183 | ARHGEF33 | Rho guanine nucleotide exchange factor 33 | 2 | 2 | ||||||||
MIRT710362 | CREB5 | cAMP responsive element binding protein 5 | 2 | 2 | ||||||||
MIRT713501 | DCAF17 | DDB1 and CUL4 associated factor 17 | 2 | 2 | ||||||||
MIRT717153 | LRRC3C | leucine rich repeat containing 3C | 2 | 2 | ||||||||
MIRT719038 | ATP1A1 | ATPase Na+/K+ transporting subunit alpha 1 | 2 | 2 | ||||||||
MIRT719489 | LSG1 | large 60S subunit nuclear export GTPase 1 | 2 | 2 | ||||||||
MIRT720284 | DPYSL3 | dihydropyrimidinase like 3 | 2 | 2 | ||||||||
MIRT732474 | NLRP3 | NLR family pyrin domain containing 3 | 2 | 0 | ||||||||
MIRT732620 | MS | multiple sclerosis | 1 | 0 | ||||||||
MIRT732968 | TGFBR2 | transforming growth factor beta receptor 2 | 3 | 0 | ||||||||
MIRT733063 | AGTR1 | angiotensin II receptor type 1 | 3 | 0 | ||||||||
MIRT733206 | ADAM10 | ADAM metallopeptidase domain 10 | 1 | 0 | ||||||||
MIRT733302 | CRP | C-reactive protein | 2 | 0 | ||||||||
MIRT734202 | PDCD4 | programmed cell death 4 | 3 | 0 | ||||||||
MIRT734467 | SIRT1 | sirtuin 1 | 2 | 0 | ||||||||
MIRT734701 | Foxo3 | forkhead box O3 | 1 | 0 | ||||||||
MIRT734889 | SP4 | Sp4 transcription factor | 2 | 0 | ||||||||
MIRT735047 | BATF | basic leucine zipper ATF-like transcription factor | 1 | 0 | ||||||||
MIRT735048 | SPI1 | Spi-1 proto-oncogene | 1 | 0 | ||||||||
MIRT735734 | PICALM | phosphatidylinositol binding clathrin assembly protein | 3 | 0 | ||||||||
MIRT735944 | TNF | tumor necrosis factor | 1 | 0 | ||||||||
MIRT736131 | MYLK | myosin light chain kinase | 2 | 0 | ||||||||
MIRT736780 | FOXP3 | forkhead box P3 | 1 | 0 | ||||||||
MIRT736781 | CEBPB | CCAAT/enhancer binding protein beta | 1 | 0 | ||||||||
MIRT736858 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 0 | ||||||||
MIRT736873 | TLR3 | toll like receptor 3 | 2 | 0 | ||||||||
MIRT736902 | CFH | complement factor H | 2 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|