pre-miRNA Information
pre-miRNA hsa-mir-4291   
Genomic Coordinates chr9: 93819357 - 93819421
Description Homo sapiens miR-4291 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4291
Sequence 11| UUCAGCAGGAACAGCU |26
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265713434 9 dbSNP
rs1433969451 12 dbSNP
rs1372852268 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ABCC12   
Synonyms MRP9
Description ATP binding cassette subfamily C member 12
Transcript NM_033226   
Expression
Putative miRNA Targets on ABCC12
3'UTR of ABCC12
(miRNA target sites are highlighted)
>ABCC12|NM_033226|3'UTR
   1 AGGTCCTGGCGGCTGATTCTAGAGGAGGAAGAGGCTCTGTGAGATGAATAGGAGGAGTCTTCAGGAGGAGGGGCTGTCCT
  81 CTCCGCAGGCAGCCCTGGTCTTCAGCCCCTCCCATCCACGGAGTGAGCTGGGGCTGAAGTTGTCCCCACTGCCATACTCA
 161 GTCCATGTCACCCCACTTGGTGGGCTTGGGGTTGGTTCTGGGTGGTGAACCGGGGCAGACCCAGCTAATGGATTAAAAAA
 241 CTGCCCTTCACCTCCCAAATCCCCAAGGGTTCCTCATGTGTTTTCACCAAAACCACCCCAGTGCCTGAGATTGAAAATAT
 321 TGTAACTTTCAGTTAGAAATCAGCCACAATAAACAACATGGGAAAATGCCTTAGGATGGAGTTTGCAAGGTTTCCTTGCC
 401 CATTATCAGAAGGAAAAAGAGCAGAATTTTCTTCTCGTTTAACCCCACTCACTTCCATCTTGACTGGGTGACAAGTGGTA
 481 ATGACACAGATTTGTAGCGTGAAAGACTGAATACAGTGTTTGGCCAAAAATTTTTTTAAAAATCATATTATATGTTTCAA
 561 TTGATCTGTTAGAATAACCAAGAAAACAAAATGCTGGAGTTTCTCTATAAATGACACTTTTATATCTTCTTTATTCGTCG
 641 TTAAAACGCGGTAGGAAATTACCCTGAAATGTCGCCTTGCAATTATTTCACTGAAGATATTCCAATTTCCATACTATTTC
 721 CTCCAATAGACCCTTGTTGCCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucGACAAGGACGACUu 5'
            |||   | ||||| 
Target 5' tcCTG--GCGGCTGAt 3'
4 - 17 110.00 -8.10
2
miRNA  3' ucgacaaggACGACUu 5'
                   |||||: 
Target 5' aaaacaaaaTGCTGGa 3'
583 - 598 104.00 -7.30
3
miRNA  3' ucgacaaggaCGACUu 5'
                    ||||| 
Target 5' gtgagctgggGCTGAa 3'
123 - 138 100.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30191124 10 COSMIC
COSN30506371 11 COSMIC
COSN30561944 21 COSMIC
COSN8601691 28 COSMIC
COSN30479160 74 COSMIC
COSN13673562 85 COSMIC
COSN6413979 98 COSMIC
COSN30461719 106 COSMIC
COSN30460857 107 COSMIC
COSN26964422 109 COSMIC
COSN30535426 120 COSMIC
COSN30178656 121 COSMIC
COSN31525705 147 COSMIC
COSN20078625 165 COSMIC
COSN30110076 215 COSMIC
COSN31505014 245 COSMIC
COSN7258234 530 COSMIC
COSN7258233 538 COSMIC
COSN21441578 543 COSMIC
COSN17181901 640 COSMIC
COSN31959678 647 COSMIC
COSN25361741 674 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1433138342 1 dbSNP
rs1338969082 2 dbSNP
rs11864455 3 dbSNP
rs1402203713 10 dbSNP
rs371058499 11 dbSNP
rs772559184 17 dbSNP
rs748418889 20 dbSNP
rs183749700 31 dbSNP
rs202012111 38 dbSNP
rs1366823962 43 dbSNP
rs768722658 45 dbSNP
rs1408910925 46 dbSNP
rs374219486 49 dbSNP
rs894660769 57 dbSNP
rs1277696425 58 dbSNP
rs1444228282 58 dbSNP
rs1476312014 59 dbSNP
rs985997407 61 dbSNP
rs1056418899 67 dbSNP
rs1345238150 69 dbSNP
rs1209734205 72 dbSNP
rs1278286700 78 dbSNP
rs920347413 84 dbSNP
rs936271975 85 dbSNP
rs1470120464 95 dbSNP
rs924912318 111 dbSNP
rs1206527219 116 dbSNP
rs979108497 119 dbSNP
rs759632420 120 dbSNP
rs1015824167 131 dbSNP
rs34076060 137 dbSNP
rs1326661582 139 dbSNP
rs971702933 144 dbSNP
rs1023080786 154 dbSNP
rs1353823850 158 dbSNP
rs751710928 163 dbSNP
rs1327268829 172 dbSNP
rs1357011466 174 dbSNP
rs1291009232 176 dbSNP
rs1233022413 194 dbSNP
rs766672330 195 dbSNP
rs1396555678 200 dbSNP
rs531902143 202 dbSNP
rs763241284 204 dbSNP
rs1214888544 205 dbSNP
rs903200296 209 dbSNP
rs61080373 210 dbSNP
rs41280919 211 dbSNP
rs76139125 212 dbSNP
rs1476535859 214 dbSNP
rs769621635 218 dbSNP
rs1050216847 220 dbSNP
rs1327842263 221 dbSNP
rs1187452055 226 dbSNP
rs375883229 231 dbSNP
rs1392280378 240 dbSNP
rs930472727 243 dbSNP
rs1318468676 244 dbSNP
rs1327802090 247 dbSNP
rs1472996677 252 dbSNP
rs761515229 261 dbSNP
rs1024369749 263 dbSNP
rs1234367972 270 dbSNP
rs1175493323 276 dbSNP
rs372772067 277 dbSNP
rs920314498 282 dbSNP
rs1250654930 287 dbSNP
rs1262553425 294 dbSNP
rs1448907630 297 dbSNP
rs1214123095 298 dbSNP
rs1191316569 304 dbSNP
rs1262114269 311 dbSNP
rs1475408856 321 dbSNP
rs1166908251 324 dbSNP
rs1457385335 329 dbSNP
rs1336651234 330 dbSNP
rs1270928941 334 dbSNP
rs894599277 344 dbSNP
rs1386524239 351 dbSNP
rs1398535068 354 dbSNP
rs1232299197 355 dbSNP
rs879049587 357 dbSNP
rs1055967878 369 dbSNP
rs1415755042 370 dbSNP
rs1000855570 375 dbSNP
rs1354068045 376 dbSNP
rs940475997 379 dbSNP
rs927607298 382 dbSNP
rs1352935085 387 dbSNP
rs1203534703 394 dbSNP
rs1285560295 399 dbSNP
rs1486151199 401 dbSNP
rs1335894302 407 dbSNP
rs531892174 412 dbSNP
rs1189767232 416 dbSNP
rs981833354 422 dbSNP
rs1255181669 426 dbSNP
rs1423128693 433 dbSNP
rs879629053 436 dbSNP
rs776571832 437 dbSNP
rs76912927 446 dbSNP
rs375095231 450 dbSNP
rs768496044 451 dbSNP
rs1392728756 452 dbSNP
rs1315118016 459 dbSNP
rs552604483 471 dbSNP
rs746479849 472 dbSNP
rs1395884855 478 dbSNP
rs1454512473 494 dbSNP
rs1338105133 496 dbSNP
rs933764009 498 dbSNP
rs921094092 499 dbSNP
rs1348822879 509 dbSNP
rs372560017 511 dbSNP
rs1277858388 521 dbSNP
rs962605381 523 dbSNP
rs191099565 530 dbSNP
rs1252565214 531 dbSNP
rs982712424 531 dbSNP
rs78719042 537 dbSNP
rs1177421483 538 dbSNP
rs1469704976 539 dbSNP
rs567533143 545 dbSNP
rs1359788746 554 dbSNP
rs1024317231 560 dbSNP
rs1171368452 593 dbSNP
rs1376780633 595 dbSNP
rs898980136 597 dbSNP
rs1299143839 599 dbSNP
rs41280917 602 dbSNP
rs1262072339 605 dbSNP
rs1236312395 610 dbSNP
rs1445260100 616 dbSNP
rs1330705088 617 dbSNP
rs940429127 624 dbSNP
rs927773380 626 dbSNP
rs1311894002 636 dbSNP
rs560808940 637 dbSNP
rs778495712 639 dbSNP
rs756435085 640 dbSNP
rs1443732296 647 dbSNP
rs544104290 647 dbSNP
rs753018847 648 dbSNP
rs181292375 649 dbSNP
rs114144417 650 dbSNP
rs1428791423 651 dbSNP
rs957641048 661 dbSNP
rs926108658 671 dbSNP
rs868252220 673 dbSNP
rs1010458413 674 dbSNP
rs1387449811 678 dbSNP
rs142350875 685 dbSNP
rs1443184820 695 dbSNP
rs1291912775 698 dbSNP
rs967828344 704 dbSNP
rs545074207 713 dbSNP
rs1019039794 716 dbSNP
rs1297376840 725 dbSNP
rs1050787168 726 dbSNP
rs933727069 733 dbSNP
rs141343813 734 dbSNP
rs1039923431 737 dbSNP
rs1978351 752 dbSNP
rs1245658605 764 dbSNP
rs779407710 771 dbSNP
rs1455544446 775 dbSNP
rs1264219957 776 dbSNP
rs909728234 784 dbSNP
rs1393123764 786 dbSNP
rs1193473871 787 dbSNP
rs372097948 788 dbSNP
rs1463514144 793 dbSNP
rs929878699 799 dbSNP
rs917234712 801 dbSNP
rs1162707415 808 dbSNP
rs1349381080 831 dbSNP
rs992879274 837 dbSNP
rs1036600881 842 dbSNP
rs1338791880 851 dbSNP
rs1399141690 854 dbSNP
rs76186659 861 dbSNP
rs1357241873 862 dbSNP
rs74441655 863 dbSNP
rs1046159112 865 dbSNP
rs979275946 868 dbSNP
rs555271375 874 dbSNP
rs947699161 884 dbSNP
rs1217401416 892 dbSNP
rs1258573373 899 dbSNP
rs894793224 899 dbSNP
rs1216308104 900 dbSNP
rs968829202 901 dbSNP
rs1258678350 906 dbSNP
rs1346385599 907 dbSNP
rs1180625710 917 dbSNP
rs1303257109 928 dbSNP
rs936247697 937 dbSNP
rs1176962373 945 dbSNP
rs1161435920 946 dbSNP
rs1020419099 948 dbSNP
rs977959728 949 dbSNP
rs1010405917 953 dbSNP
rs1377063101 955 dbSNP
rs946251800 956 dbSNP
rs1283523919 971 dbSNP
rs890741428 981 dbSNP
rs1224949109 985 dbSNP
rs1306509475 986 dbSNP
rs1029727679 988 dbSNP
rs1352479746 989 dbSNP
rs997885180 993 dbSNP
rs899515281 994 dbSNP
rs190233309 999 dbSNP
rs953470453 1019 dbSNP
rs1444481550 1020 dbSNP
rs941095078 1024 dbSNP
rs1432890360 1040 dbSNP
rs888241157 1044 dbSNP
rs1046969514 1050 dbSNP
rs370135234 1055 dbSNP
rs917203521 1061 dbSNP
rs1378569092 1062 dbSNP
rs1439256494 1063 dbSNP
rs1174500418 1069 dbSNP
rs1171896414 1078 dbSNP
rs1397194871 1080 dbSNP
rs993222023 1081 dbSNP
rs937337482 1082 dbSNP
rs927299971 1084 dbSNP
rs1412536578 1085 dbSNP
rs1333326445 1090 dbSNP
rs1355008947 1091 dbSNP
rs569416401 1092 dbSNP
rs978781624 1095 dbSNP
rs1374565960 1099 dbSNP
rs1190681623 1101 dbSNP
rs1328614620 1102 dbSNP
rs1477292263 1106 dbSNP
rs1375521679 1111 dbSNP
rs1234464004 1112 dbSNP
rs1305152740 1114 dbSNP
rs1257726834 1118 dbSNP
rs1014849467 1119 dbSNP
rs968778140 1126 dbSNP
rs367862420 1136 dbSNP
rs1005094582 1137 dbSNP
rs552523184 1138 dbSNP
rs1020407651 1139 dbSNP
rs988967179 1150 dbSNP
rs1457367244 1153 dbSNP
rs955110195 1166 dbSNP
rs1194413211 1167 dbSNP
rs1030559290 1171 dbSNP
rs906383178 1172 dbSNP
rs1419995766 1177 dbSNP
rs1025249080 1179 dbSNP
rs1011936659 1186 dbSNP
rs996844354 1190 dbSNP
rs549222430 1193 dbSNP
rs186255962 1201 dbSNP
rs1212433527 1208 dbSNP
rs763185339 1216 dbSNP
rs28560105 1217 dbSNP
rs936350624 1219 dbSNP
rs1340507948 1227 dbSNP
rs904746880 1229 dbSNP
rs1005302017 1232 dbSNP
rs888229954 1236 dbSNP
rs1046920111 1239 dbSNP
rs866035968 1241 dbSNP
rs929819885 1242 dbSNP
rs546698798 1243 dbSNP
rs895660357 1245 dbSNP
rs750656104 1248 dbSNP
rs1450037986 1256 dbSNP
rs987674327 1264 dbSNP
rs1057021334 1267 dbSNP
rs1478670521 1281 dbSNP
rs377416480 1289 dbSNP
rs922012569 1294 dbSNP
rs765387735 1296 dbSNP
rs973367137 1303 dbSNP
rs1461921283 1309 dbSNP
rs181736425 1310 dbSNP
rs963385694 1311 dbSNP
rs761617100 1322 dbSNP
rs1043079325 1325 dbSNP
rs1333493197 1330 dbSNP
rs560968261 1334 dbSNP
rs750092840 1350 dbSNP
rs550427699 1352 dbSNP
rs947460893 1353 dbSNP
rs913341630 1354 dbSNP
rs1340413791 1359 dbSNP
rs1234468258 1374 dbSNP
rs988874417 1375 dbSNP
rs1354327327 1389 dbSNP
rs1418188078 1392 dbSNP
rs1209375361 1395 dbSNP
rs1189592994 1396 dbSNP
rs776317384 1404 dbSNP
rs868738199 1407 dbSNP
rs894865227 1408 dbSNP
rs1032066876 1409 dbSNP
rs1181829988 1412 dbSNP
rs1000466104 1419 dbSNP
rs1158694020 1422 dbSNP
rs1362035941 1426 dbSNP
rs902161495 1436 dbSNP
rs1296688596 1438 dbSNP
rs1360305816 1446 dbSNP
rs530748195 1447 dbSNP
rs1315418554 1457 dbSNP
rs763913627 1465 dbSNP
rs1244113566 1466 dbSNP
rs1280240807 1471 dbSNP
rs565070967 1474 dbSNP
rs1356061204 1475 dbSNP
rs1010480414 1477 dbSNP
rs1284959451 1479 dbSNP
rs544923680 1480 dbSNP
rs1485874684 1490 dbSNP
rs189875737 1497 dbSNP
rs1202028229 1510 dbSNP
rs1441811834 1513 dbSNP
rs761566790 1515 dbSNP
rs760582286 1516 dbSNP
rs1017943493 1527 dbSNP
rs1005252843 1529 dbSNP
rs1381653428 1531 dbSNP
rs890742780 1541 dbSNP
rs775463547 1542 dbSNP
rs1025378136 1547 dbSNP
rs377332366 1550 dbSNP
rs1395363329 1554 dbSNP
rs1051895677 1563 dbSNP
rs751354587 1567 dbSNP
rs994337936 1568 dbSNP
rs1395980151 1570 dbSNP
rs932144625 1573 dbSNP
rs1379214874 1575 dbSNP
rs1444738765 1587 dbSNP
rs895616079 1590 dbSNP
rs921981396 1592 dbSNP
rs1057367609 1601 dbSNP
rs185743951 1603 dbSNP
rs905809965 1606 dbSNP
rs1043019998 1637 dbSNP
rs1254060743 1641 dbSNP
rs1231672131 1646 dbSNP
rs907855184 1647 dbSNP
rs542763610 1652 dbSNP
rs983889754 1657 dbSNP
rs1280209154 1664 dbSNP
rs573642017 1667 dbSNP
rs1253203379 1671 dbSNP
rs917842611 1679 dbSNP
rs1178625772 1683 dbSNP
rs913248423 1685 dbSNP
rs1445830715 1686 dbSNP
rs990586271 1688 dbSNP
rs1172005392 1694 dbSNP
rs1053098982 1698 dbSNP
rs933401801 1706 dbSNP
rs1330815346 1714 dbSNP
rs923459321 1717 dbSNP
rs1032162188 1718 dbSNP
rs1459560697 1728 dbSNP
rs144480809 1734 dbSNP
rs964975522 1752 dbSNP
rs1298849230 1753 dbSNP
rs909489401 1756 dbSNP
rs966897535 1758 dbSNP
rs985060706 1761 dbSNP
rs1020616689 1774 dbSNP
rs1259882814 1782 dbSNP
rs1316027415 1805 dbSNP
rs952331185 1809 dbSNP
rs1025325226 1815 dbSNP
rs1469235773 1819 dbSNP
rs1052029197 1822 dbSNP
rs993893374 1824 dbSNP
rs1266316153 1829 dbSNP
rs996322272 1829 dbSNP
rs374903896 1830 dbSNP
rs139741989 1836 dbSNP
rs1426371569 1837 dbSNP
rs575894010 1839 dbSNP
rs1464549830 1841 dbSNP
rs1212133715 1845 dbSNP
rs773909257 1849 dbSNP
rs1037900100 1851 dbSNP
rs1285155613 1869 dbSNP
rs1035522458 1879 dbSNP
rs1225587344 1880 dbSNP
rs1459582731 1886 dbSNP
rs745385448 1893 dbSNP
rs907990070 1895 dbSNP
rs1348593458 1901 dbSNP
rs1400344267 1903 dbSNP
rs181942798 1904 dbSNP
rs1001796883 1913 dbSNP
rs905722000 1918 dbSNP
rs1445941836 1929 dbSNP
rs538815737 1938 dbSNP
rs917811485 1941 dbSNP
rs773998933 1966 dbSNP
rs990681188 1973 dbSNP
rs1322993565 1975 dbSNP
rs1218814933 1979 dbSNP
rs1264472428 1983 dbSNP
rs144847930 1985 dbSNP
rs546662005 1990 dbSNP
rs1265826115 2003 dbSNP
rs925110112 2005 dbSNP
rs1193583182 2011 dbSNP
rs542194065 2014 dbSNP
rs536362903 2017 dbSNP
rs1162813970 2018 dbSNP
rs1368069882 2019 dbSNP
rs1420560431 2025 dbSNP
rs188158088 2027 dbSNP
rs375098736 2031 dbSNP
rs1348966378 2036 dbSNP
rs891756278 2037 dbSNP
rs1053085938 2041 dbSNP
rs111768275 2045 dbSNP
rs530833361 2055 dbSNP
rs1226088135 2060 dbSNP
rs1311428393 2065 dbSNP
rs1353916018 2072 dbSNP
rs1241892642 2077 dbSNP
rs1288520214 2080 dbSNP
rs1039186721 2082 dbSNP
rs1157467747 2089 dbSNP
rs565075965 2099 dbSNP
rs909395978 2104 dbSNP
rs1238522004 2105 dbSNP
rs551666015 2106 dbSNP
rs528230179 2113 dbSNP
rs1180137539 2114 dbSNP
rs955233304 2117 dbSNP
rs376577379 2124 dbSNP
rs929548108 2129 dbSNP
rs918254415 2132 dbSNP
rs59721874 2136 dbSNP
rs900787301 2137 dbSNP
rs1176575564 2141 dbSNP
rs959805253 2142 dbSNP
rs183606462 2161 dbSNP
rs1360786062 2164 dbSNP
rs1445766710 2172 dbSNP
rs979888323 2177 dbSNP
rs1377004962 2178 dbSNP
rs1448440201 2178 dbSNP
rs1306618368 2185 dbSNP
rs1352595160 2190 dbSNP
rs1223534673 2204 dbSNP
rs115596218 2206 dbSNP
rs1021415556 2212 dbSNP
rs563268524 2217 dbSNP
rs1243137136 2222 dbSNP
rs543482819 2223 dbSNP
rs191837867 2226 dbSNP
rs558937116 2230 dbSNP
rs1031656784 2234 dbSNP
rs997948019 2243 dbSNP
rs901863724 2244 dbSNP
rs1439352253 2245 dbSNP
rs1218210761 2248 dbSNP
rs1039502513 2257 dbSNP
rs943443986 2278 dbSNP
rs75379854 2281 dbSNP
rs1401019203 2283 dbSNP
rs1285421239 2298 dbSNP
rs1049297464 2300 dbSNP
rs949522825 2313 dbSNP
rs1328720843 2314 dbSNP
rs1375630279 2317 dbSNP
rs1436763055 2325 dbSNP
rs896479871 2331 dbSNP
rs1217891640 2332 dbSNP
rs1348541347 2333 dbSNP
rs573322969 2336 dbSNP
rs1263037715 2337 dbSNP
rs1305474427 2337 dbSNP
rs553186492 2347 dbSNP
rs1256263322 2349 dbSNP
rs747507349 2352 dbSNP
rs116045459 2355 dbSNP
rs1366638448 2358 dbSNP
rs72802141 2359 dbSNP
rs556929622 2361 dbSNP
rs1432474913 2364 dbSNP
rs1190460003 2378 dbSNP
rs1424217370 2380 dbSNP
rs1343004233 2383 dbSNP
rs1297073205 2385 dbSNP
rs1167841598 2388 dbSNP
rs78634100 2389 dbSNP
rs945215340 2395 dbSNP
rs913627433 2398 dbSNP
rs542381853 2408 dbSNP
rs928328561 2411 dbSNP
rs1434724698 2422 dbSNP
rs571621889 2423 dbSNP
rs1433039318 2444 dbSNP
rs1341627938 2448 dbSNP
rs1221019193 2449 dbSNP
rs1276313697 2452 dbSNP
rs1338822912 2455 dbSNP
rs139463800 2460 dbSNP
rs975113252 2466 dbSNP
rs1188599561 2473 dbSNP
rs964917903 2474 dbSNP
rs1221415344 2490 dbSNP
rs764016932 2493 dbSNP
rs1474552715 2516 dbSNP
rs1262695426 2522 dbSNP
rs1021403990 2525 dbSNP
rs1489190645 2535 dbSNP
rs1191409721 2542 dbSNP
rs528419233 2545 dbSNP
rs1372490425 2556 dbSNP
rs1472827202 2557 dbSNP
rs1164534660 2559 dbSNP
rs1211714476 2561 dbSNP
rs1016935062 2562 dbSNP
rs1486682710 2571 dbSNP
rs1404420560 2574 dbSNP
rs879591474 2580 dbSNP
rs1282469118 2586 dbSNP
rs565854486 2588 dbSNP
rs1302864587 2594 dbSNP
rs1006367197 2596 dbSNP
rs886590567 2599 dbSNP
rs1207916197 2601 dbSNP
rs989968717 2605 dbSNP
rs1326410606 2608 dbSNP
rs1245578111 2609 dbSNP
rs1286064614 2610 dbSNP
rs1354433228 2622 dbSNP
rs1026514061 2624 dbSNP
rs8046592 2625 dbSNP
rs896615036 2630 dbSNP
rs1296031992 2636 dbSNP
rs1055010556 2643 dbSNP
rs1216062953 2650 dbSNP
rs1337989955 2651 dbSNP
rs1031984812 2658 dbSNP
rs1158872390 2661 dbSNP
rs1381845669 2663 dbSNP
rs1157236082 2669 dbSNP
rs1414909050 2669 dbSNP
rs1356813574 2681 dbSNP
rs1384824986 2690 dbSNP
rs938022338 2694 dbSNP
rs1336172117 2703 dbSNP
rs762771731 2706 dbSNP
rs1452078368 2711 dbSNP
rs1356169416 2715 dbSNP
rs903753276 2716 dbSNP
rs1311657983 2719 dbSNP
rs1044052357 2721 dbSNP
rs901808826 2722 dbSNP
rs532900023 2729 dbSNP
rs528987544 2730 dbSNP
rs60250034 2738 dbSNP
rs1178769518 2740 dbSNP
rs1007646396 2741 dbSNP
rs1239588270 2753 dbSNP
rs1437472928 2757 dbSNP
rs887896176 2758 dbSNP
rs986685513 2773 dbSNP
rs1188886551 2774 dbSNP
rs114776028 2776 dbSNP
rs1255506841 2779 dbSNP
rs150535687 2786 dbSNP
rs1379345923 2791 dbSNP
rs757386377 2792 dbSNP
rs1331458599 2794 dbSNP
rs1057083172 2801 dbSNP
rs1235226732 2803 dbSNP
rs939620827 2804 dbSNP
rs928286558 2812 dbSNP
rs1251765070 2817 dbSNP
rs1198667672 2818 dbSNP
rs1044100396 2819 dbSNP
rs1206419581 2820 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000416054.1 | 3UTR | aggagagcccugcugagagagaggaagaugcuguuuuggcu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000416054.1 | 3UTR | aggagagcccugcugagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084067
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SantaCruzAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugcuguuuuggcu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugcuguuuu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084075
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb
Location of target site ENST00000416054.1 | 3UTR | agagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugcuguuuuggcu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000416054.1 | 3UTR | gagagagaggaagaugc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102445 CALU calumenin 2 4
MIRT108677 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT125969 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT179018 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT379033 CDK6 cyclin dependent kinase 6 2 6
MIRT442473 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 2
MIRT442910 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT442979 ZNF736 zinc finger protein 736 2 2
MIRT445663 TNFSF15 TNF superfamily member 15 2 2
MIRT446237 FZD6 frizzled class receptor 6 2 2
MIRT448860 FAM49B family with sequence similarity 49 member B 2 2
MIRT455559 TRAF1 TNF receptor associated factor 1 2 2
MIRT459704 ZNF641 zinc finger protein 641 2 2
MIRT460608 FEM1A fem-1 homolog A 2 2
MIRT462251 LAMA4 laminin subunit alpha 4 2 2
MIRT462469 FIZ1 FLT3 interacting zinc finger 1 2 2
MIRT466656 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT466841 STX6 syntaxin 6 2 2
MIRT471403 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471517 PCGF3 polycomb group ring finger 3 2 2
MIRT471681 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT472858 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT474813 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT474931 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475814 HDGF heparin binding growth factor 2 2
MIRT480434 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT480903 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT481478 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484982 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485019 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485036 TMEM189 transmembrane protein 189 2 8
MIRT495074 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT496004 CD180 CD180 molecule 2 2
MIRT500675 TRIM37 tripartite motif containing 37 2 2
MIRT504544 ZNF417 zinc finger protein 417 2 6
MIRT506782 KLHL15 kelch like family member 15 2 6
MIRT507256 FGF2 fibroblast growth factor 2 2 6
MIRT507386 EN2 engrailed homeobox 2 2 2
MIRT512505 BTBD19 BTB domain containing 19 2 2
MIRT516903 CTSB cathepsin B 2 2
MIRT528124 PPP1R10 protein phosphatase 1 regulatory subunit 10 2 2
MIRT528874 ATF3 activating transcription factor 3 2 2
MIRT536091 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT541079 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541099 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT545360 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT545831 ZNF367 zinc finger protein 367 2 4
MIRT547115 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547312 NPTN neuroplastin 2 2
MIRT547959 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT549943 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT550749 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT565145 TUBB2A tubulin beta 2A class IIa 2 2
MIRT571050 POLQ DNA polymerase theta 2 2
MIRT571361 ZNF45 zinc finger protein 45 2 2
MIRT610133 FOXI2 forkhead box I2 2 2
MIRT613145 DSE dermatan sulfate epimerase 2 2
MIRT613379 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615752 C6 complement C6 2 2
MIRT616460 ADRA2B adrenoceptor alpha 2B 2 2
MIRT616719 FEM1B fem-1 homolog B 2 2
MIRT618312 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT631491 RASSF4 Ras association domain family member 4 2 2
MIRT643134 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 2 2
MIRT643482 DISC1 disrupted in schizophrenia 1 2 2
MIRT649715 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT653542 SLC38A7 solute carrier family 38 member 7 2 2
MIRT666307 SLC22A3 solute carrier family 22 member 3 2 2
MIRT692005 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT696838 ARL2BP ADP ribosylation factor like GTPase 2 binding protein 2 2
MIRT698204 TMEM248 transmembrane protein 248 2 2
MIRT703316 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT709376 FAM13A family with sequence similarity 13 member A 2 2
MIRT710112 MED23 mediator complex subunit 23 2 2
MIRT711975 HOMER2 homer scaffolding protein 2 2 2
MIRT712275 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT714108 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT719113 MAML1 mastermind like transcriptional coactivator 1 2 2
MIRT719727 SLC39A11 solute carrier family 39 member 11 2 2
MIRT720018 TFAP2C transcription factor AP-2 gamma 2 2
MIRT720358 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720372 NUDT3 nudix hydrolase 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4291 Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-4291 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-4291 Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-4291 Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4291 Radioactivity Iodine resistant High Papillary Thyroid Cancer tissue
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4291 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4291 Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission