pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4720 |
Genomic Coordinates | chr16: 81385018 - 81385093 |
Description | Homo sapiens miR-4720 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4720-5p | ||||||||||||||||||||||||
Sequence | 4| CCUGGCAUAUUUGGUAUAACUU |25 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | DPF2 | ||||||||||||||||||||
Synonyms | REQ, UBID4, ubi-d4 | ||||||||||||||||||||
Description | double PHD fingers 2 | ||||||||||||||||||||
Transcript | NM_006268 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on DPF2 | |||||||||||||||||||||
3'UTR of DPF2 (miRNA target sites are highlighted) |
>DPF2|NM_006268|3'UTR 1 TGTGGCCACCCACCTGCTCCCCGACATATCTAAGGCTGTTTCTCTCCTCCACTTCATATTTCATACCCATCTTTCCCTTC 81 TTCCTCCTCTCCTTCACAAATCCAGAGAACCTTGGGGTGGTTGTGCCAGCCTGCCTTTGGCAGCTGCAAGCTGAGGTGGC 161 AGCTCTGACCACCTCTGGCCCCAGGCCCTCAGGGAGAAAGGAGCAACACACTGCCCCTAGGCGTGCGTGTGGCCCAGTTT 241 CTCTCTGCTCTCCATTAAGTGCATTCACTCTGCTTGCCTTGGGCCCAGCCCCTGGTGATCACAGGGTTCAAACAGTGTCC 321 TCCTAGAAAGAGTGGGAGAGCAGCTCACTTCTCTGTGTTCTGCCTCCCCTCTGGTCTCCAGAGTTTTCCTGTCCTCTAGA 401 GGCAAGCCAGGCCAGGGAGCTGGGAGCGAGCAAGCTGAGGCCACGTCCACAAGGAGCTTTTCATGCCCCTGTGCCGCATA 481 GCCTCACCTCTTTCCTCCAGAGTGGCTCTCTGCGGCCCTGTGTTCCTGCTACAGAGTGTTCTTTTCTGGAGTCAGGATGT 561 TCTCGGTCACCCTCCTGGTTCTGCCCTGTCCCATTCCACCCCACCCCAGGGGGAACAGTAGCTTCACCTTGTTATTCCCA 641 TTGCTCTCCTGGCTCACTCTTACGGTCGGTCTCCAGTGACTGAAGCATTCCCCACCCTTGGAATTTCTCATCTTCTGCCT 721 CCCTTCCTACTCCTTTTGGTTTTGTGGGGAGAGGGGAAGGATCAGGGGGCCAGGCCAGCAGCTCGGGGGCCACAAGGAGA 801 TGGATAATGTGCCTGTTTTTTAACACAACAAAAAAGCCTACCTCCAAAATCCCCTTTTTGTTCTTCCTGGACCTGGGCAT 881 TCAGCCTCCTGCTCTTAACTGAATTGGGAGCCTCTGCCACCTGCCCCGTGTATCCTGGCTCTCAGCTCATGGGGAAGCCA 961 CATAGACATCCCTTTCTTCCCTTGCACGCTCGCTAGCAGCTGGTAAGGTCTTCACACCCTGATTCCTCAAGTTTTCTGCT 1041 TAGTGGCACTGACATTAAGTAGTGGGGGGACAGTCCATGCCAGGACACCCTGGAGTAGCCTTCCCCCTTGGCCGTGGGCA 1121 GGCCCTAACTCACTGTCGCTTTGGAGTTGAGGTGTCTTTTTTTTTTCTTTCTTTAGTTCCTGTATTCTAAACATTAGTAA 1201 AAATAAATGTTTTTACACAGAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084081 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb |
Location of target site | ENST00000528416.1 | 3UTR | CAGGGAAGGGAACGAUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
40 hsa-miR-4720-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT064869 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT099937 | SOX4 | SRY-box 4 | 2 | 2 | ||||||||
MIRT204534 | SLC39A10 | solute carrier family 39 member 10 | 2 | 4 | ||||||||
MIRT221679 | ZNRF2 | zinc and ring finger 2 | 2 | 2 | ||||||||
MIRT296659 | MRGBP | MRG domain binding protein | 2 | 6 | ||||||||
MIRT331634 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | 2 | 2 | ||||||||
MIRT337078 | RER1 | retention in endoplasmic reticulum sorting receptor 1 | 2 | 2 | ||||||||
MIRT497580 | PTCHD4 | patched domain containing 4 | 2 | 2 | ||||||||
MIRT498838 | NAPEPLD | N-acyl phosphatidylethanolamine phospholipase D | 2 | 4 | ||||||||
MIRT502561 | EBAG9 | estrogen receptor binding site associated, antigen, 9 | 2 | 2 | ||||||||
MIRT508128 | AMD1 | adenosylmethionine decarboxylase 1 | 2 | 2 | ||||||||
MIRT511875 | GOLGA7 | golgin A7 | 2 | 6 | ||||||||
MIRT512924 | UBL4A | ubiquitin like 4A | 2 | 2 | ||||||||
MIRT513833 | KLHL15 | kelch like family member 15 | 2 | 6 | ||||||||
MIRT515889 | FAM182B | family with sequence similarity 182 member B | 2 | 2 | ||||||||
MIRT520201 | WASL | Wiskott-Aldrich syndrome like | 2 | 2 | ||||||||
MIRT526045 | GMDS | GDP-mannose 4,6-dehydratase | 2 | 2 | ||||||||
MIRT533601 | TNPO1 | transportin 1 | 2 | 2 | ||||||||
MIRT535539 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | 2 | 6 | ||||||||
MIRT541150 | PABPC1 | poly(A) binding protein cytoplasmic 1 | 2 | 4 | ||||||||
MIRT549609 | TMEM101 | transmembrane protein 101 | 2 | 2 | ||||||||
MIRT552630 | ZBTB41 | zinc finger and BTB domain containing 41 | 2 | 2 | ||||||||
MIRT555503 | PNISR | PNN interacting serine and arginine rich protein | 2 | 2 | ||||||||
MIRT560225 | PCNA | proliferating cell nuclear antigen | 2 | 2 | ||||||||
MIRT561671 | RAPGEF2 | Rap guanine nucleotide exchange factor 2 | 2 | 2 | ||||||||
MIRT562103 | ITGB1 | integrin subunit beta 1 | 2 | 2 | ||||||||
MIRT570710 | E2F3 | E2F transcription factor 3 | 2 | 2 | ||||||||
MIRT570802 | CKAP2L | cytoskeleton associated protein 2 like | 2 | 2 | ||||||||
MIRT615261 | DPF2 | double PHD fingers 2 | 2 | 2 | ||||||||
MIRT615389 | ZNF747 | zinc finger protein 747 | 2 | 2 | ||||||||
MIRT616621 | KCNJ11 | potassium voltage-gated channel subfamily J member 11 | 2 | 4 | ||||||||
MIRT641085 | ZKSCAN2 | zinc finger with KRAB and SCAN domains 2 | 2 | 2 | ||||||||
MIRT654971 | PLEKHA2 | pleckstrin homology domain containing A2 | 2 | 2 | ||||||||
MIRT667033 | PDE3A | phosphodiesterase 3A | 2 | 2 | ||||||||
MIRT677217 | RASSF6 | Ras association domain family member 6 | 2 | 2 | ||||||||
MIRT699243 | SLC6A8 | solute carrier family 6 member 8 | 2 | 2 | ||||||||
MIRT711673 | TRMT5 | tRNA methyltransferase 5 | 2 | 2 | ||||||||
MIRT713922 | CACNA2D1 | calcium voltage-gated channel auxiliary subunit alpha2delta 1 | 2 | 2 | ||||||||
MIRT722736 | BRMS1 | breast cancer metastasis suppressor 1 | 2 | 2 | ||||||||
MIRT724997 | CDC27 | cell division cycle 27 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|