pre-miRNA Information
pre-miRNA hsa-mir-6818   
Genomic Coordinates chr22: 30007049 - 30007113
Description Homo sapiens miR-6818 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6818-3p
Sequence 44| UUGUCUCUUGUUCCUCACACAG |65
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1325627700 2 dbSNP
rs750902684 3 dbSNP
rs756542190 6 dbSNP
rs1365035732 17 dbSNP
Putative Targets

Gene Information
Gene Symbol FAM26E
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000368599.3 | 3UTR | AGAGGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000368599.3 | 3UTR | GAGUGGAGAGAGAGGGAGAGAGAGAGAGACAGAGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000368599.3 | 3UTR | UGGAGAGAGAGGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000368599.3 | 3UTR | UGGAGAGAGAGGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000368599.3 | 3UTR | GAGAGAGAGGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084075
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb
Location of target site ENST00000368599.3 | 3UTR | GAGAGGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000368599.3 | 3UTR | GGGAGAGAGAGAGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
150 hsa-miR-6818-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT112122 TIMM17A translocase of inner mitochondrial membrane 17A 2 6
MIRT262243 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT446689 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT449923 TPST2 tyrosylprotein sulfotransferase 2 2 2
MIRT464356 USP12P1 ubiquitin specific peptidase 12 pseudogene 1 2 2
MIRT485703 CBX7 chromobox 7 2 2
MIRT497478 XPR1 xenotropic and polytropic retrovirus receptor 1 2 4
MIRT499435 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT514246 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT515032 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515065 PLA2G2C phospholipase A2 group IIC 2 2
MIRT520235 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT523685 FHL2 four and a half LIM domains 2 2 4
MIRT525524 FSIP2 fibrous sheath interacting protein 2 2 2
MIRT525838 FAR2 fatty acyl-CoA reductase 2 2 2
MIRT528583 PTGER3 prostaglandin E receptor 3 2 2
MIRT530404 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT530703 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT535118 PLSCR4 phospholipid scramblase 4 2 2
MIRT539880 IRGQ immunity related GTPase Q 2 2
MIRT540195 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540938 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541501 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT542544 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542559 ZNF280B zinc finger protein 280B 2 2
MIRT542689 RPS15A ribosomal protein S15a 2 2
MIRT548759 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT549735 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT553060 ULK1 unc-51 like autophagy activating kinase 1 2 2
MIRT556303 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT560816 DIP2A disco interacting protein 2 homolog A 2 2
MIRT567455 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT575143 Cd93 CD93 antigen 2 2
MIRT607217 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT607286 CD300E CD300e molecule 2 6
MIRT607302 RREB1 ras responsive element binding protein 1 2 6
MIRT608645 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT611095 MYO1F myosin IF 2 4
MIRT611576 CLEC4D C-type lectin domain family 4 member D 2 2
MIRT614271 WSCD2 WSC domain containing 2 2 2
MIRT614855 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT617114 KANK2 KN motif and ankyrin repeat domains 2 2 2
MIRT618002 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618028 CTU1 cytosolic thiouridylase subunit 1 2 2
MIRT619062 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619289 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619356 CFHR5 complement factor H related 5 2 2
MIRT620725 CCL16 C-C motif chemokine ligand 16 2 2
MIRT620913 LRRTM2 leucine rich repeat transmembrane neuronal 2 2 2
MIRT621902 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT622025 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT622556 PTPN3 protein tyrosine phosphatase, non-receptor type 3 2 2
MIRT623137 NCKAP1 NCK associated protein 1 2 2
MIRT623140 NAV2 neuron navigator 2 2 2
MIRT623701 HHAT hedgehog acyltransferase 2 2
MIRT624602 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT625944 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT625988 SPATA17 spermatogenesis associated 17 2 2
MIRT628028 LSAMP limbic system-associated membrane protein 2 2
MIRT635521 MC2R melanocortin 2 receptor 2 2
MIRT638916 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT639796 EPX eosinophil peroxidase 2 2
MIRT640344 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT644806 VLDLR very low density lipoprotein receptor 2 2
MIRT645303 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645629 SYTL4 synaptotagmin like 4 2 2
MIRT645683 TBC1D13 TBC1 domain family member 13 2 2
MIRT646216 DUSP10 dual specificity phosphatase 10 2 2
MIRT648505 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT649748 UTP20 UTP20, small subunit processome component 2 2
MIRT649797 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT650482 UFM1 ubiquitin fold modifier 1 2 2
MIRT653199 SP9 Sp9 transcription factor 2 2
MIRT655741 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT659978 C2CD2L C2CD2 like 2 2
MIRT660350 BAG4 BCL2 associated athanogene 4 2 2
MIRT662185 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663290 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT666817 PRCP prolylcarboxypeptidase 2 2
MIRT671665 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT671838 PDE3A phosphodiesterase 3A 2 2
MIRT672193 F2 coagulation factor II, thrombin 2 2
MIRT673870 KLF2 Kruppel like factor 2 2 2
MIRT683563 CARD8 caspase recruitment domain family member 8 2 2
MIRT684545 ZNF708 zinc finger protein 708 2 2
MIRT685140 TACR3 tachykinin receptor 3 2 2
MIRT685413 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686039 SLC5A5 solute carrier family 5 member 5 2 2
MIRT686126 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT687473 NHLRC2 NHL repeat containing 2 2 2
MIRT687946 HHIP hedgehog interacting protein 2 2
MIRT688171 FRRS1 ferric chelate reductase 1 2 2
MIRT688295 FAM208A family with sequence similarity 208 member A 2 2
MIRT689044 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT689194 ZNF574 zinc finger protein 574 2 2
MIRT691253 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT695358 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696674 APOC3 apolipoprotein C3 2 2
MIRT697358 ZNF394 zinc finger protein 394 2 2
MIRT697604 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697726 USP6NL USP6 N-terminal like 2 2
MIRT697776 UBXN7 UBX domain protein 7 2 2
MIRT698478 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT698984 SPAG9 sperm associated antigen 9 2 2
MIRT699851 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT700172 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT704339 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT704589 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705836 AHCY adenosylhomocysteinase 2 2
MIRT707085 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707132 TRA2B transformer 2 beta homolog 2 2
MIRT707145 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707234 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707347 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707445 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707494 AXL AXL receptor tyrosine kinase 2 2
MIRT707638 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707690 FAM118A family with sequence similarity 118 member A 2 2
MIRT707706 CDC6 cell division cycle 6 2 2
MIRT707817 TMEM170A transmembrane protein 170A 2 2
MIRT707957 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT707996 NUDT4 nudix hydrolase 4 2 2
MIRT708026 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708058 LIX1L limb and CNS expressed 1 like 2 2
MIRT708089 KIAA1671 KIAA1671 2 2
MIRT708125 GK5 glycerol kinase 5 (putative) 2 2
MIRT708194 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708201 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT710503 BSDC1 BSD domain containing 1 2 2
MIRT711308 IFNGR2 interferon gamma receptor 2 2 2
MIRT711740 DTX1 deltex E3 ubiquitin ligase 1 2 2
MIRT713202 SOCS6 suppressor of cytokine signaling 6 2 2
MIRT714380 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT715210 NPVF neuropeptide VF precursor 2 2
MIRT715559 EPHB4 EPH receptor B4 2 2
MIRT715835 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT716680 HLA-B major histocompatibility complex, class I, B 2 2
MIRT717660 THBS2 thrombospondin 2 2 2
MIRT718132 PALM paralemmin 2 2
MIRT718322 METTL7A methyltransferase like 7A 2 2
MIRT720693 RNF217 ring finger protein 217 2 2
MIRT720727 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT721376 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT721983 FAM214B family with sequence similarity 214 member B 2 2
MIRT722163 MRPS15 mitochondrial ribosomal protein S15 2 2
MIRT722881 MOB3A MOB kinase activator 3A 2 2
MIRT723218 FMNL3 formin like 3 2 2
MIRT723788 MUC17 mucin 17, cell surface associated 2 2
MIRT724093 TMEM199 transmembrane protein 199 2 2
MIRT725265 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6818-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-6818-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6818-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)

Error report submission