pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4793 |
Genomic Coordinates | chr3: 48644194 - 48644280 |
Description | Homo sapiens miR-4793 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4793-3p | |||||||||||||||
Sequence | 58| UCUGCACUGUGAGUUGGCUGGCU |80 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SNRPD1 | ||||||||||||||||||||
Synonyms | HsT2456, SMD1, SNRPD, Sm-D1 | ||||||||||||||||||||
Description | small nuclear ribonucleoprotein D1 polypeptide | ||||||||||||||||||||
Transcript | NM_006938 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SNRPD1 | |||||||||||||||||||||
3'UTR of SNRPD1 (miRNA target sites are highlighted) |
>SNRPD1|NM_006938|3'UTR 1 TGTCTCTCAAGATTTCAAAGTCATATGAGATTTGGGATATTTTTTGTACAGGTTGTGTTTGTTTATGTCAGTTTTTAATA 81 AACATAAATGTGGGACAGAGCTGTCTATTTAGTATATCAAAGTTTTAGTAGTTTCCTCCACATTCACGAAATTACCACAG 161 TGAGAGCTAAGCATTTCTACTGGGCAGTTTCATTTTTAGTTGATCAGGTTTTAAGTTTTTGAACTAAAATTTTTCTTTTT 241 CTTTTTATGATGAATAAGGTTAAAATAAAAGCCTTAGACAAATTAAATTTGGCAGAGTTTAATTGAGCAAAGGACAATTC 321 ACAAATCAGGTAGCCCCTGAACCATAATAGGCTCAGAGGCTTCAGCCCAGCTGCATAGTTGAAGATTTATGGACAGAAGG 401 AAAGTGATGTATGGAAAATGGAAGTGAGATACAGCAACAGCCGGATTAGTTACAGTTCAGCGTTTGCCTTATTTGAATAT 481 GGTTTGAACAGTTCGCTGTCTTTGGTTGGCTGAAACTTAGTGATTGCCACAAGAGTAGGGTACCGTCTGTTTACACGTCC 561 AGTTAGGCTACAGTTCTATGTACTGAGAAACCTTTAAGCTGAACTTGAGATATGTAAAGAGACTTTAGGCTAAACTTAAC 641 AATATATATAGGATATATACCCTTCTACTTCACATGCACTGAATATGCATTTTATTGCTTTACTCTTCATTCTGTGGCAC 721 CTACCCACAGGGGAAGTAAGAAGTTTGTTTTGGTATTTCGGAAACTAAAGTCCTTATGGGATGGGGTCTAGAATTGATTC 801 TCCTTTCCTGAGTTTTACTCCACGGAGTCTTAGGTACCTGGTAAAAAGTTGTCTTCTAAATTAAGGGTCATTGCTTTGTT 881 GTCTAGCTGCTAATGTCTTACTTTTGTTTCTTTTGCTTTTTAATCAGTTCTTAATAGGATATAGTTTTATGTTTTCCAAG 961 TTATAACTTGGAGTTAATGGTCACTAGATTATCAGTTATGAGCAGTGTTAAAATCTCCTATTAATGTGTAATGTACCTGT 1041 CAGTGCCTCCTTTATTAAGGGGTTCTTTGAGAATAAAAGAGAAAAGACCTACTTTATTTGACAGCAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | Hela | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000300413.5 | 3UTR | AGUGCAGUGGUGCGAUCUUGGCUCACUGCAACCUCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084079 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000300413.5 | 3UTR | UGCUGUGUCACCCAGGCUGGAGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
296 hsa-miR-4793-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT092332 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT131237 | ATG2A | autophagy related 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT145926 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT206559 | SOCS5 | suppressor of cytokine signaling 5 | ![]() |
![]() |
2 | 8 | ||||||
MIRT226455 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT337662 | ZNF695 | zinc finger protein 695 | ![]() |
![]() |
2 | 2 | ||||||
MIRT405828 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455113 | RILPL1 | Rab interacting lysosomal protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456756 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 4 | ||||||
MIRT457974 | RGS9BP | regulator of G protein signaling 9 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT458173 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT458245 | SLC9A7 | solute carrier family 9 member A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466145 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT474981 | KATNAL1 | katanin catalytic subunit A1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475601 | HMGB2 | high mobility group box 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT480759 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT481156 | AVL9 | AVL9 cell migration associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT482155 | AK2 | adenylate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488386 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT496575 | KIF18B | kinesin family member 18B | ![]() |
![]() |
2 | 2 | ||||||
MIRT498411 | TXNDC16 | thioredoxin domain containing 16 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504547 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505417 | TCF7L2 | transcription factor 7 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509349 | ALDH9A1 | aldehyde dehydrogenase 9 family member A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512164 | CD164 | CD164 molecule | ![]() |
![]() |
2 | 6 | ||||||
MIRT517238 | PRIM1 | DNA primase subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518671 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519298 | MLH1 | mutL homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523662 | FOSL2 | FOS like 2, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT525452 | GPATCH2L | G-patch domain containing 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT539847 | ZNF766 | zinc finger protein 766 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540076 | SSH3 | slingshot protein phosphatase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540320 | PIGR | polymeric immunoglobulin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT540548 | MAGI3 | membrane associated guanylate kinase, WW and PDZ domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540759 | UTP6 | UTP6, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT541545 | HIATL2 | major facilitator superfamily domain containing 14C | ![]() |
![]() |
2 | 2 | ||||||
MIRT541553 | SLC35E1 | solute carrier family 35 member E1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541666 | ATP8B3 | ATPase phospholipid transporting 8B3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541722 | TFDP2 | transcription factor Dp-2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541800 | DUSP28 | dual specificity phosphatase 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541816 | SMU1 | DNA replication regulator and spliceosomal factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT541907 | VWA7 | von Willebrand factor A domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542154 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT542207 | C14orf142 | GON7, KEOPS complex subunit homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT542233 | FUT9 | fucosyltransferase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542320 | SERPING1 | serpin family G member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542369 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT542476 | APOC3 | apolipoprotein C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542641 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT542660 | TAF11 | TATA-box binding protein associated factor 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542749 | PRRG4 | proline rich and Gla domain 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542789 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545442 | FGFRL1 | fibroblast growth factor receptor like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546206 | TOR1AIP2 | torsin 1A interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552270 | RAB3D | RAB3D, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT552655 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554134 | SMARCA5 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556795 | KIAA1958 | KIAA1958 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564762 | ZHX3 | zinc fingers and homeoboxes 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569428 | STX7 | syntaxin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573245 | ZBTB46 | zinc finger and BTB domain containing 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607390 | LANCL3 | LanC like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607430 | NOTCH2NL | notch 2 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT607452 | ZNF543 | zinc finger protein 543 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607580 | TANGO2 | transport and golgi organization 2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT607748 | ANGPT4 | angiopoietin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607907 | SPRYD4 | SPRY domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608703 | GMPR | guanosine monophosphate reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT612127 | NDUFA10 | NADH:ubiquinone oxidoreductase subunit A10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612786 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT616692 | LPL | lipoprotein lipase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617045 | ZNF610 | zinc finger protein 610 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617091 | ZNF43 | zinc finger protein 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617314 | MBOAT1 | membrane bound O-acyltransferase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617355 | MELK | maternal embryonic leucine zipper kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617486 | ALG9 | ALG9, alpha-1,2-mannosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617579 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617669 | RSRC1 | arginine and serine rich coiled-coil 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617722 | TRAPPC2 | trafficking protein particle complex 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT617893 | PTCHD3 | patched domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617982 | ZNF234 | zinc finger protein 234 | ![]() |
![]() |
2 | 4 | ||||||
MIRT618434 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT618732 | HIST1H2AH | histone cluster 1 H2A family member h | ![]() |
![]() |
2 | 2 | ||||||
MIRT619045 | CASS4 | Cas scaffolding protein family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619573 | ATAT1 | alpha tubulin acetyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT619671 | CYP1A2 | cytochrome P450 family 1 subfamily A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619887 | ABHD17B | abhydrolase domain containing 17B | ![]() |
![]() |
2 | 2 | ||||||
MIRT620519 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | ![]() |
![]() |
2 | 4 | ||||||
MIRT620535 | AVPR1A | arginine vasopressin receptor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT620996 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621304 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622086 | SRPX2 | sushi repeat containing protein, X-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622168 | SMYD1 | SET and MYND domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622543 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622761 | PGM3 | phosphoglucomutase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622885 | PDCL3 | phosducin like 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT623130 | NDUFC2 | NADH:ubiquinone oxidoreductase subunit C2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624840 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625047 | MBD3 | methyl-CpG binding domain protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625059 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625508 | PPAPDC1A | phospholipid phosphatase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625573 | ANKRD42 | ankyrin repeat domain 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626133 | SNRNP48 | small nuclear ribonucleoprotein U11/U12 subunit 48 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626327 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT626765 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT626798 | CSE1L | chromosome segregation 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT627212 | ZC3H12B | zinc finger CCCH-type containing 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT627225 | ZBTB8B | zinc finger and BTB domain containing 8B | ![]() |
![]() |
2 | 4 | ||||||
MIRT627256 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628190 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628466 | AHSA2 | activator of HSP90 ATPase homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628627 | CCT4 | chaperonin containing TCP1 subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629040 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT630847 | ACACB | acetyl-CoA carboxylase beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT631721 | RNASEH2B | ribonuclease H2 subunit B | ![]() |
![]() |
2 | 2 | ||||||
MIRT632264 | USP1 | ubiquitin specific peptidase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT632571 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT633992 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635211 | ZNF286A | zinc finger protein 286A | ![]() |
![]() |
2 | 4 | ||||||
MIRT635249 | ELOVL6 | ELOVL fatty acid elongase 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT635261 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635283 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT635663 | DTX3L | deltex E3 ubiquitin ligase 3L | ![]() |
![]() |
2 | 2 | ||||||
MIRT636251 | SEC63 | SEC63 homolog, protein translocation regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT636564 | EPB41 | erythrocyte membrane protein band 4.1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636814 | TBC1D24 | TBC1 domain family member 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637358 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637473 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637505 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT637861 | SC5D | sterol-C5-desaturase | ![]() |
![]() |
2 | 2 | ||||||
MIRT638080 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638096 | ZBTB8A | zinc finger and BTB domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT638174 | TMED4 | transmembrane p24 trafficking protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638201 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638278 | SH2B3 | SH2B adaptor protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638714 | FUT11 | fucosyltransferase 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638852 | CLMP | CXADR like membrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT639815 | TMED8 | transmembrane p24 trafficking protein family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640879 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640937 | FAM129A | family with sequence similarity 129 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT640971 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641642 | GNAZ | G protein subunit alpha z | ![]() |
![]() |
2 | 2 | ||||||
MIRT641931 | SLC25A16 | solute carrier family 25 member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642136 | CRY2 | cryptochrome circadian clock 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643199 | JAK3 | Janus kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643256 | ZNF566 | zinc finger protein 566 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643378 | TRIM16L | tripartite motif containing 16 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT643683 | AMER3 | APC membrane recruitment protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643728 | MCMDC2 | minichromosome maintenance domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643949 | CCDC141 | coiled-coil domain containing 141 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644915 | SERF1B | small EDRK-rich factor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT645163 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645547 | PABPC1L2B | poly(A) binding protein cytoplasmic 1 like 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT645550 | PABPC1L2A | poly(A) binding protein cytoplasmic 1 like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT645572 | TACR2 | tachykinin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646697 | SERF1A | small EDRK-rich factor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT647806 | FRMD8 | FERM domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647903 | CIRH1A | UTP4, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT648978 | ACAD8 | acyl-CoA dehydrogenase family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649907 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT650224 | SIGLEC9 | sialic acid binding Ig like lectin 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT651880 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651935 | UBN1 | ubinuclein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652839 | TACO1 | translational activator of cytochrome c oxidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT652994 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT654800 | PRICKLE1 | prickle planar cell polarity protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655591 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT658760 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659358 | CRKL | CRK like proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT660717 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660737 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT661088 | TMEM145 | transmembrane protein 145 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661176 | S1PR2 | sphingosine-1-phosphate receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662005 | ZNF445 | zinc finger protein 445 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662178 | KIAA1210 | KIAA1210 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662270 | OR51E2 | olfactory receptor family 51 subfamily E member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663046 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663476 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664039 | RPL27A | ribosomal protein L27a | ![]() |
![]() |
2 | 2 | ||||||
MIRT664096 | ZDHHC24 | zinc finger DHHC-type containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664109 | FUT1 | fucosyltransferase 1 (H blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT664317 | CD209 | CD209 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT664455 | BBS5 | Bardet-Biedl syndrome 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664595 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 4 | ||||||
MIRT664694 | DBF4 | DBF4 zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT665162 | SF3A1 | splicing factor 3a subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665214 | RBM22 | RNA binding motif protein 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665254 | ZNF286B | zinc finger protein 286B | ![]() |
![]() |
2 | 2 | ||||||
MIRT665268 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT665606 | TTC39A | tetratricopeptide repeat domain 39A | ![]() |
![]() |
2 | 2 | ||||||
MIRT665830 | TIMELESS | timeless circadian clock | ![]() |
![]() |
2 | 2 | ||||||
MIRT666201 | SMARCC1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666546 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666602 | REEP3 | receptor accessory protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666862 | POU2F3 | POU class 2 homeobox 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT666886 | POLA2 | DNA polymerase alpha 2, accessory subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT667158 | NRXN3 | neurexin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667252 | NEK9 | NIMA related kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667419 | MFSD2A | major facilitator superfamily domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT667434 | METTL8 | methyltransferase like 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668023 | HAUS3 | HAUS augmin like complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668062 | GPR75 | G protein-coupled receptor 75 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668070 | GOSR1 | golgi SNAP receptor complex member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668607 | EHD4 | EH domain containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT668694 | DNAL1 | dynein axonemal light chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668782 | DAAM1 | dishevelled associated activator of morphogenesis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669037 | CHEK1 | checkpoint kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669044 | CHAF1B | chromatin assembly factor 1 subunit B | ![]() |
![]() |
2 | 4 | ||||||
MIRT669156 | CCNG1 | cyclin G1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670090 | ABCF3 | ATP binding cassette subfamily F member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670206 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672488 | FUS | FUS RNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT673830 | SLC11A2 | solute carrier family 11 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675481 | VEGFC | vascular endothelial growth factor C | ![]() |
![]() |
2 | 2 | ||||||
MIRT675634 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677913 | HIST1H2BN | histone cluster 1 H2B family member n | ![]() |
![]() |
2 | 2 | ||||||
MIRT678420 | ANKRD36 | ankyrin repeat domain 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678626 | OLFML2A | olfactomedin like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT678791 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679561 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT680743 | CA5B | carbonic anhydrase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT682481 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT682701 | PSMD9 | proteasome 26S subunit, non-ATPase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682759 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT682811 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682847 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682896 | XIAP | X-linked inhibitor of apoptosis | ![]() |
![]() |
2 | 2 | ||||||
MIRT682916 | FAM73A | mitoguardin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682935 | ZNF292 | zinc finger protein 292 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682953 | RPL12 | ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682972 | NF2 | neurofibromin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683033 | SUSD5 | sushi domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683081 | A1BG | alpha-1-B glycoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT683105 | TIMM10B | translocase of inner mitochondrial membrane 10B | ![]() |
![]() |
2 | 2 | ||||||
MIRT686640 | TMEM184C | transmembrane protein 184C | ![]() |
![]() |
2 | 2 | ||||||
MIRT687444 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688401 | EMC8 | ER membrane protein complex subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688886 | C3orf70 | chromosome 3 open reading frame 70 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689148 | IRAK1BP1 | interleukin 1 receptor associated kinase 1 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689234 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689306 | C5AR2 | complement component 5a receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689364 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689498 | SCARF1 | scavenger receptor class F member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689655 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689897 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690150 | PPIL6 | peptidylprolyl isomerase like 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690601 | C17orf105 | chromosome 17 open reading frame 105 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690805 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690946 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691388 | ATP13A4 | ATPase 13A4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691408 | DNA2 | DNA replication helicase/nuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692175 | LRRC3C | leucine rich repeat containing 3C | ![]() |
![]() |
2 | 2 | ||||||
MIRT692235 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693283 | GINM1 | glycoprotein integral membrane 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693439 | TPGS1 | tubulin polyglutamylase complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693460 | HIST1H2AG | histone cluster 1 H2A family member g | ![]() |
![]() |
2 | 2 | ||||||
MIRT693768 | ZNF383 | zinc finger protein 383 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694018 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694236 | ZNF749 | zinc finger protein 749 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694321 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694347 | CHST6 | carbohydrate sulfotransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694430 | MCF2L2 | MCF.2 cell line derived transforming sequence-like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695763 | WDR35 | WD repeat domain 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696167 | TIPIN | TIMELESS interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT696417 | DOCK7 | dedicator of cytokinesis 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696543 | C3 | complement C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696998 | CCDC80 | coiled-coil domain containing 80 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697232 | ZYG11A | zyg-11 family member A, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT697806 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT697944 | TVP23C | trans-golgi network vesicle protein 23 homolog C | ![]() |
![]() |
2 | 2 | ||||||
MIRT698161 | TNFRSF13C | TNF receptor superfamily member 13C | ![]() |
![]() |
2 | 2 | ||||||
MIRT698778 | STK4 | serine/threonine kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700259 | RBM12B | RNA binding motif protein 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT700970 | PDK3 | pyruvate dehydrogenase kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701251 | NUP35 | nucleoporin 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701607 | MYPN | myopalladin | ![]() |
![]() |
2 | 2 | ||||||
MIRT702457 | KIAA1467 | family with sequence similarity 234 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT702613 | ITPRIPL2 | inositol 1,4,5-trisphosphate receptor interacting protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702691 | IRGQ | immunity related GTPase Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT702934 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702991 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703148 | GPR137C | G protein-coupled receptor 137C | ![]() |
![]() |
2 | 2 | ||||||
MIRT703980 | EMC1 | ER membrane protein complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704569 | CLPX | caseinolytic mitochondrial matrix peptidase chaperone subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT705065 | C4orf32 | family with sequence similarity 241 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT705447 | ATL2 | atlastin GTPase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705856 | AFF3 | AF4/FMR2 family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705886 | ADIPOR2 | adiponectin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714370 | HP1BP3 | heterochromatin protein 1 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715784 | PHF12 | PHD finger protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715864 | KIAA0101 | PCNA clamp associated factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT715947 | NUP93 | nucleoporin 93 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716132 | THOC5 | THO complex 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717084 | EBF4 | early B-cell factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725424 | HNRNPA3 | heterogeneous nuclear ribonucleoprotein A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT736091 | GREM1 | gremlin 1, DAN family BMP antagonist | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|